Incidental Mutation 'R8524:Hspa9'
ID 658736
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Name heat shock protein 9
Synonyms C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock # R8524 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34937414-34954357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34954244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 3 (S3G)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
AlphaFold P38647
Predicted Effect unknown
Transcript: ENSMUST00000025217
AA Change: S3G
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: S3G

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc65 A T 15: 98,709,109 T66S probably benign Het
Cers1 G A 8: 70,331,248 G282D probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Col25a1 C A 3: 130,549,224 P350H probably damaging Het
Coq5 T C 5: 115,284,553 I172T probably damaging Het
Dand5 A T 8: 84,822,427 L85* probably null Het
Dnah8 T A 17: 30,715,498 W1486R possibly damaging Het
Dpp8 T C 9: 65,043,707 Y142H probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gng7 T A 10: 80,951,703 H42L possibly damaging Het
Gps2 T C 11: 69,915,006 V93A probably damaging Het
Impg2 A G 16: 56,218,394 N132D probably benign Het
Jak2 A T 19: 29,295,705 N643I probably damaging Het
Kcng2 T C 18: 80,295,681 D464G probably benign Het
Kdm4b T A 17: 56,399,384 C833S probably damaging Het
Ly86 G A 13: 37,376,893 D77N probably damaging Het
Map7 G A 10: 20,266,823 A330T probably benign Het
Mettl1 T C 10: 127,042,039 S21P probably damaging Het
Mga A G 2: 119,941,516 Y1540C probably damaging Het
Mpp4 A G 1: 59,144,681 L300P probably damaging Het
Mycbp2 A G 14: 103,155,459 M3222T probably benign Het
Nat8f6 A G 6: 85,808,559 Y203H probably benign Het
Nod1 C T 6: 54,948,075 E84K probably damaging Het
Olfr1066 T C 2: 86,455,617 Y218C probably damaging Het
Olfr1367 T C 13: 21,347,078 V50A probably benign Het
Olfr1418 A G 19: 11,855,081 Y291H probably damaging Het
Padi2 A G 4: 140,949,695 N598S possibly damaging Het
Pclo C T 5: 14,679,507 probably benign Het
Pdik1l T G 4: 134,286,610 E12D probably benign Het
Plcg1 G A 2: 160,761,467 probably null Het
Rasgrf1 A G 9: 89,915,585 H172R possibly damaging Het
Rnf41 C G 10: 128,435,430 R70G possibly damaging Het
Rsbn1 A T 3: 103,928,371 K203* probably null Het
Setbp1 T C 18: 78,858,754 D566G probably damaging Het
Slc7a14 A C 3: 31,224,133 V441G possibly damaging Het
Sorl1 T A 9: 41,974,074 N2077I probably damaging Het
Spryd3 G A 15: 102,118,148 R363* probably null Het
St6galnac1 G T 11: 116,767,721 R306S possibly damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Trim35 C T 14: 66,307,044 R276C probably damaging Het
Trim55 A T 3: 19,670,949 D210V probably benign Het
Tsg101 A T 7: 46,892,367 D279E probably benign Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7404:Hspa9 UTSW 18 34943276 missense possibly damaging 0.76
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R8830:Hspa9 UTSW 18 34948104 critical splice donor site probably null
R8987:Hspa9 UTSW 18 34947929 missense probably damaging 1.00
R9028:Hspa9 UTSW 18 34942031 missense probably damaging 1.00
R9184:Hspa9 UTSW 18 34949115 missense possibly damaging 0.87
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCACAGAAGGTCCGTTACATC -3'
(R):5'- CGGACACGTAGTCTCTAGTCAG -3'

Sequencing Primer
(F):5'- AGAAGGTCCGTTACATCCCTTCG -3'
(R):5'- TAGTCTCTAGTCAGGCAGCAC -3'
Posted On 2021-01-18