Incidental Mutation 'R8525:Galnt13'
ID658743
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R8525 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55060476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 390 (V390M)
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068595
AA Change: V390M

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: V390M

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112634
AA Change: V390M

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: V390M

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112635
AA Change: V390M

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: V390M

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112636
AA Change: V390M

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: V390M

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A T 7: 27,556,511 N8Y possibly damaging Het
4932414N04Rik A T 2: 68,729,034 D197V possibly damaging Het
Aar2 G A 2: 156,555,917 R283Q probably benign Het
Acsf2 T A 11: 94,572,620 I119F probably benign Het
Adamtsl1 C T 4: 86,277,010 P572S probably damaging Het
Adh5 A T 3: 138,451,334 I219F probably damaging Het
Arhgap23 T A 11: 97,490,084 F1098I probably damaging Het
Bicc1 G T 10: 70,943,535 H674Q possibly damaging Het
Ccdc39 C T 3: 33,814,704 R786H probably benign Het
Ccr1l1 A G 9: 123,977,552 I286T possibly damaging Het
Ccr9 T A 9: 123,779,667 M138K probably benign Het
Dbh T C 2: 27,165,786 F91L probably benign Het
Dip2a T A 10: 76,274,281 probably null Het
Eif3j1 A G 2: 122,050,510 I148V probably damaging Het
Etl4 A G 2: 20,530,081 R116G probably damaging Het
Exoc6 C A 19: 37,608,992 Q614K possibly damaging Het
Gabpb1 A G 2: 126,652,274 S144P possibly damaging Het
Gimap5 T C 6: 48,752,567 S24P probably benign Het
Gm4778 A G 3: 94,266,555 N290S probably benign Het
Gm4924 T A 10: 82,377,867 probably benign Het
Gucy1a2 T A 9: 3,865,365 I613K probably damaging Het
Hsp90ab1 T A 17: 45,569,800 E115D probably benign Het
Hspg2 T C 4: 137,539,448 V1949A probably damaging Het
Ice2 A G 9: 69,411,416 Y294C probably damaging Het
Il17ra T G 6: 120,474,337 Y157* probably null Het
Ipo13 T C 4: 117,904,929 E416G probably damaging Het
Large1 C T 8: 72,837,492 V549M probably damaging Het
Mmp17 A G 5: 129,602,207 D390G probably damaging Het
Mrps10 T G 17: 47,372,446 I102R probably damaging Het
Mycbp2 A G 14: 103,212,719 L1712P probably damaging Het
Nipal2 A G 15: 34,584,669 M251T probably damaging Het
Nup160 G A 2: 90,718,096 probably null Het
Olfr201 A T 16: 59,269,208 V153D probably benign Het
Olfr523 T C 7: 140,176,342 I74T probably damaging Het
Pdcd11 G A 19: 47,092,898 D34N possibly damaging Het
Pigb G T 9: 73,017,527 P450Q probably damaging Het
Radil A C 5: 142,488,501 L730R probably damaging Het
Rsbn1 G T 3: 103,914,222 probably benign Het
Sec24b T C 3: 130,011,818 D264G probably damaging Het
Shank3 C G 15: 89,547,770 S906C probably damaging Het
Slc1a3 A G 15: 8,642,975 V340A possibly damaging Het
Slc1a3 A T 15: 8,650,939 I145N possibly damaging Het
Slc35f4 A T 14: 49,304,224 S208T possibly damaging Het
Tmem132b A G 5: 125,638,316 D363G probably benign Het
Tox3 T G 8: 90,274,681 N34T probably damaging Het
Vmn1r231 T A 17: 20,889,739 I305L probably benign Het
Vps18 A G 2: 119,290,230 I57V possibly damaging Het
Zfhx4 T G 3: 5,399,543 L1587R probably damaging Het
Zfp112 A G 7: 24,125,897 N430S probably benign Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8539:Galnt13 UTSW 2 54933572 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCACTGTGCAGCAAACATTTAC -3'
(R):5'- GCTCCTTAGAAATTGCTCCATTTG -3'

Sequencing Primer
(F):5'- CACTGTGCAGCAAACATTTACATTTC -3'
(R):5'- CCGGATAGATGTTTTCCAGG -3'
Posted On2021-01-18