Incidental Mutation 'R8525:Zfp112'
ID658764
Institutional Source Beutler Lab
Gene Symbol Zfp112
Ensembl Gene ENSMUSG00000052675
Gene Namezinc finger protein 112
Synonyms
Accession Numbers

Genbank: NM_021307; MGI: 1929115

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R8525 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24112314-24127952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24125897 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 430 (N430S)
Ref Sequence ENSEMBL: ENSMUSP00000150734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005413] [ENSMUST00000120006] [ENSMUST00000215113]
Predicted Effect probably benign
Transcript: ENSMUST00000005413
AA Change: N434S

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005413
Gene: ENSMUSG00000052675
AA Change: N434S

DomainStartEndE-ValueType
KRAB 8 68 7.93e-27 SMART
low complexity region 385 397 N/A INTRINSIC
ZnF_C2H2 523 545 4.11e-2 SMART
ZnF_C2H2 551 573 3.44e-4 SMART
ZnF_C2H2 579 601 1.6e-4 SMART
ZnF_C2H2 607 629 1.5e-4 SMART
ZnF_C2H2 635 657 3.89e-3 SMART
ZnF_C2H2 663 685 1.58e-3 SMART
ZnF_C2H2 691 713 6.42e-4 SMART
ZnF_C2H2 719 741 5.99e-4 SMART
ZnF_C2H2 747 769 7.78e-3 SMART
ZnF_C2H2 775 797 3.95e-4 SMART
ZnF_C2H2 803 825 2.01e-5 SMART
ZnF_C2H2 831 853 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120006
AA Change: N428S

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113031
Gene: ENSMUSG00000052675
AA Change: N428S

DomainStartEndE-ValueType
KRAB 2 62 7.93e-27 SMART
low complexity region 379 391 N/A INTRINSIC
ZnF_C2H2 517 539 4.11e-2 SMART
ZnF_C2H2 545 567 3.44e-4 SMART
ZnF_C2H2 573 595 1.6e-4 SMART
ZnF_C2H2 601 623 1.5e-4 SMART
ZnF_C2H2 629 651 3.89e-3 SMART
ZnF_C2H2 657 679 1.58e-3 SMART
ZnF_C2H2 685 707 6.42e-4 SMART
ZnF_C2H2 713 735 5.99e-4 SMART
ZnF_C2H2 741 763 7.78e-3 SMART
ZnF_C2H2 769 791 3.95e-4 SMART
ZnF_C2H2 797 819 2.01e-5 SMART
ZnF_C2H2 825 847 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215113
AA Change: N430S

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A T 7: 27,556,511 N8Y possibly damaging Het
4932414N04Rik A T 2: 68,729,034 D197V possibly damaging Het
Aar2 G A 2: 156,555,917 R283Q probably benign Het
Acsf2 T A 11: 94,572,620 I119F probably benign Het
Adamtsl1 C T 4: 86,277,010 P572S probably damaging Het
Adh5 A T 3: 138,451,334 I219F probably damaging Het
Arhgap23 T A 11: 97,490,084 F1098I probably damaging Het
Bicc1 G T 10: 70,943,535 H674Q possibly damaging Het
Ccdc39 C T 3: 33,814,704 R786H probably benign Het
Ccr1l1 A G 9: 123,977,552 I286T possibly damaging Het
Ccr9 T A 9: 123,779,667 M138K probably benign Het
Dbh T C 2: 27,165,786 F91L probably benign Het
Dip2a T A 10: 76,274,281 probably null Het
Eif3j1 A G 2: 122,050,510 I148V probably damaging Het
Etl4 A G 2: 20,530,081 R116G probably damaging Het
Exoc6 C A 19: 37,608,992 Q614K possibly damaging Het
Gabpb1 A G 2: 126,652,274 S144P possibly damaging Het
Galnt13 G A 2: 55,060,476 V390M possibly damaging Het
Gimap5 T C 6: 48,752,567 S24P probably benign Het
Gm4778 A G 3: 94,266,555 N290S probably benign Het
Gm4924 T A 10: 82,377,867 probably benign Het
Gucy1a2 T A 9: 3,865,365 I613K probably damaging Het
Hsp90ab1 T A 17: 45,569,800 E115D probably benign Het
Hspg2 T C 4: 137,539,448 V1949A probably damaging Het
Ice2 A G 9: 69,411,416 Y294C probably damaging Het
Il17ra T G 6: 120,474,337 Y157* probably null Het
Ipo13 T C 4: 117,904,929 E416G probably damaging Het
Large1 C T 8: 72,837,492 V549M probably damaging Het
Mmp17 A G 5: 129,602,207 D390G probably damaging Het
Mrps10 T G 17: 47,372,446 I102R probably damaging Het
Mycbp2 A G 14: 103,212,719 L1712P probably damaging Het
Nipal2 A G 15: 34,584,669 M251T probably damaging Het
Nup160 G A 2: 90,718,096 probably null Het
Olfr201 A T 16: 59,269,208 V153D probably benign Het
Olfr523 T C 7: 140,176,342 I74T probably damaging Het
Pdcd11 G A 19: 47,092,898 D34N possibly damaging Het
Pigb G T 9: 73,017,527 P450Q probably damaging Het
Radil A C 5: 142,488,501 L730R probably damaging Het
Rsbn1 G T 3: 103,914,222 probably benign Het
Sec24b T C 3: 130,011,818 D264G probably damaging Het
Shank3 C G 15: 89,547,770 S906C probably damaging Het
Slc1a3 A G 15: 8,642,975 V340A possibly damaging Het
Slc1a3 A T 15: 8,650,939 I145N possibly damaging Het
Slc35f4 A T 14: 49,304,224 S208T possibly damaging Het
Tmem132b A G 5: 125,638,316 D363G probably benign Het
Tox3 T G 8: 90,274,681 N34T probably damaging Het
Vmn1r231 T A 17: 20,889,739 I305L probably benign Het
Vps18 A G 2: 119,290,230 I57V possibly damaging Het
Zfhx4 T G 3: 5,399,543 L1587R probably damaging Het
Other mutations in Zfp112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Zfp112 APN 7 24122243 missense probably damaging 1.00
IGL00575:Zfp112 APN 7 24126332 missense probably damaging 1.00
IGL00944:Zfp112 APN 7 24125596 missense probably benign 0.02
IGL01662:Zfp112 APN 7 24125954 missense probably benign 0.44
IGL03383:Zfp112 APN 7 24125678 missense probably damaging 1.00
2107:Zfp112 UTSW 7 24126841 missense probably damaging 1.00
FR4737:Zfp112 UTSW 7 24125407 small insertion probably benign
R0566:Zfp112 UTSW 7 24125677 missense probably benign 0.09
R0581:Zfp112 UTSW 7 24125863 missense probably damaging 0.97
R0613:Zfp112 UTSW 7 24127028 missense probably benign 0.33
R1521:Zfp112 UTSW 7 24125785 missense probably damaging 0.97
R1614:Zfp112 UTSW 7 24126599 missense probably damaging 1.00
R1827:Zfp112 UTSW 7 24124960 missense probably damaging 1.00
R1906:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R1920:Zfp112 UTSW 7 24125237 missense probably benign 0.01
R2008:Zfp112 UTSW 7 24126751 missense probably damaging 1.00
R2012:Zfp112 UTSW 7 24125300 missense possibly damaging 0.69
R2192:Zfp112 UTSW 7 24125438 missense probably damaging 0.98
R2985:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R4191:Zfp112 UTSW 7 24126143 missense probably benign 0.19
R4373:Zfp112 UTSW 7 24125048 missense probably damaging 0.99
R4374:Zfp112 UTSW 7 24126373 missense probably damaging 1.00
R4674:Zfp112 UTSW 7 24126974 missense probably damaging 1.00
R4676:Zfp112 UTSW 7 24126260 missense probably damaging 0.97
R5023:Zfp112 UTSW 7 24126484 missense probably damaging 0.99
R5198:Zfp112 UTSW 7 24124856 missense possibly damaging 0.49
R6559:Zfp112 UTSW 7 24126463 nonsense probably null
R6835:Zfp112 UTSW 7 24125806 missense probably damaging 1.00
R6946:Zfp112 UTSW 7 24125341 missense probably damaging 0.98
R7263:Zfp112 UTSW 7 24125527 missense probably benign 0.04
R7512:Zfp112 UTSW 7 24125179 missense possibly damaging 0.73
R7533:Zfp112 UTSW 7 24125327 missense possibly damaging 0.58
R7535:Zfp112 UTSW 7 24126710 missense probably damaging 1.00
R8179:Zfp112 UTSW 7 24125638 missense probably benign 0.10
R8516:Zfp112 UTSW 7 24123964 missense probably benign
R8701:Zfp112 UTSW 7 24125740 missense probably damaging 1.00
R8756:Zfp112 UTSW 7 24125572 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAAGCAAGCTGTTGGTAGTCC -3'
(R):5'- AGAAGGCTTTTCTCGAATGTGG -3'

Sequencing Primer
(F):5'- GGTAGTCCTGTCCACTGCAATAG -3'
(R):5'- CGAATGTGGAGTTTCTGATGGCC -3'
Posted On2021-01-18