Incidental Mutation 'R8525:Olfr523'
ID658766
Institutional Source Beutler Lab
Gene Symbol Olfr523
Ensembl Gene ENSMUSG00000051051
Gene Nameolfactory receptor 523
SynonymsMOR104-4, GA_x6K02T2PBJ9-42327937-42328872
Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8525 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140173217-140178758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140176342 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 74 (I74T)
Ref Sequence ENSEMBL: ENSMUSP00000149562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]
Predicted Effect probably damaging
Transcript: ENSMUST00000055890
AA Change: I80T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: I80T

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_4 40 317 1.6e-50 PFAM
Pfam:7tm_1 50 299 1.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209314
AA Change: I74T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213953
AA Change: I74T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214272
AA Change: I74T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215785
AA Change: I74T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216023
AA Change: I74T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A T 7: 27,556,511 N8Y possibly damaging Het
4932414N04Rik A T 2: 68,729,034 D197V possibly damaging Het
Aar2 G A 2: 156,555,917 R283Q probably benign Het
Acsf2 T A 11: 94,572,620 I119F probably benign Het
Adamtsl1 C T 4: 86,277,010 P572S probably damaging Het
Adh5 A T 3: 138,451,334 I219F probably damaging Het
Arhgap23 T A 11: 97,490,084 F1098I probably damaging Het
Bicc1 G T 10: 70,943,535 H674Q possibly damaging Het
Ccdc39 C T 3: 33,814,704 R786H probably benign Het
Ccr1l1 A G 9: 123,977,552 I286T possibly damaging Het
Ccr9 T A 9: 123,779,667 M138K probably benign Het
Dbh T C 2: 27,165,786 F91L probably benign Het
Dip2a T A 10: 76,274,281 probably null Het
Eif3j1 A G 2: 122,050,510 I148V probably damaging Het
Etl4 A G 2: 20,530,081 R116G probably damaging Het
Exoc6 C A 19: 37,608,992 Q614K possibly damaging Het
Gabpb1 A G 2: 126,652,274 S144P possibly damaging Het
Galnt13 G A 2: 55,060,476 V390M possibly damaging Het
Gimap5 T C 6: 48,752,567 S24P probably benign Het
Gm4778 A G 3: 94,266,555 N290S probably benign Het
Gm4924 T A 10: 82,377,867 probably benign Het
Gucy1a2 T A 9: 3,865,365 I613K probably damaging Het
Hsp90ab1 T A 17: 45,569,800 E115D probably benign Het
Hspg2 T C 4: 137,539,448 V1949A probably damaging Het
Ice2 A G 9: 69,411,416 Y294C probably damaging Het
Il17ra T G 6: 120,474,337 Y157* probably null Het
Ipo13 T C 4: 117,904,929 E416G probably damaging Het
Large1 C T 8: 72,837,492 V549M probably damaging Het
Mmp17 A G 5: 129,602,207 D390G probably damaging Het
Mrps10 T G 17: 47,372,446 I102R probably damaging Het
Mycbp2 A G 14: 103,212,719 L1712P probably damaging Het
Nipal2 A G 15: 34,584,669 M251T probably damaging Het
Nup160 G A 2: 90,718,096 probably null Het
Olfr201 A T 16: 59,269,208 V153D probably benign Het
Pdcd11 G A 19: 47,092,898 D34N possibly damaging Het
Pigb G T 9: 73,017,527 P450Q probably damaging Het
Radil A C 5: 142,488,501 L730R probably damaging Het
Rsbn1 G T 3: 103,914,222 probably benign Het
Sec24b T C 3: 130,011,818 D264G probably damaging Het
Shank3 C G 15: 89,547,770 S906C probably damaging Het
Slc1a3 A G 15: 8,642,975 V340A possibly damaging Het
Slc1a3 A T 15: 8,650,939 I145N possibly damaging Het
Slc35f4 A T 14: 49,304,224 S208T possibly damaging Het
Tmem132b A G 5: 125,638,316 D363G probably benign Het
Tox3 T G 8: 90,274,681 N34T probably damaging Het
Vmn1r231 T A 17: 20,889,739 I305L probably benign Het
Vps18 A G 2: 119,290,230 I57V possibly damaging Het
Zfhx4 T G 3: 5,399,543 L1587R probably damaging Het
Zfp112 A G 7: 24,125,897 N430S probably benign Het
Other mutations in Olfr523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr523 APN 7 140176615 missense probably damaging 1.00
IGL01759:Olfr523 APN 7 140176534 missense probably benign 0.00
D3080:Olfr523 UTSW 7 140176362 missense possibly damaging 0.94
R0503:Olfr523 UTSW 7 140176441 missense possibly damaging 0.95
R1644:Olfr523 UTSW 7 140176648 missense probably benign 0.12
R1760:Olfr523 UTSW 7 140176275 missense probably damaging 1.00
R1852:Olfr523 UTSW 7 140176561 nonsense probably null
R1960:Olfr523 UTSW 7 140176683 missense probably benign 0.37
R2363:Olfr523 UTSW 7 140176965 missense probably damaging 1.00
R3700:Olfr523 UTSW 7 140176214 missense possibly damaging 0.54
R4626:Olfr523 UTSW 7 140176446 missense probably damaging 1.00
R4678:Olfr523 UTSW 7 140176228 missense probably benign 0.21
R4779:Olfr523 UTSW 7 140176450 missense probably damaging 1.00
R4999:Olfr523 UTSW 7 140177020 missense probably damaging 1.00
R5663:Olfr523 UTSW 7 140176321 missense probably damaging 1.00
R7352:Olfr523 UTSW 7 140176525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTGGCCAGAACCTGTC -3'
(R):5'- GTGTCATGATGCCACCGTAG -3'

Sequencing Primer
(F):5'- CAGGACCATTCATCTTGCTGGG -3'
(R):5'- ATGCCACCGTAGCGCAG -3'
Posted On2021-01-18