Incidental Mutation 'R8525:Large1'
ID 658767
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock # R8525 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72837492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 549 (V549M)
Ref Sequence ENSEMBL: ENSMUSP00000148336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably damaging
Transcript: ENSMUST00000004497
AA Change: V549M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: V549M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119826
AA Change: V549M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: V549M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212459
AA Change: V549M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A T 7: 27,556,511 N8Y possibly damaging Het
4932414N04Rik A T 2: 68,729,034 D197V possibly damaging Het
Aar2 G A 2: 156,555,917 R283Q probably benign Het
Acsf2 T A 11: 94,572,620 I119F probably benign Het
Adamtsl1 C T 4: 86,277,010 P572S probably damaging Het
Adh5 A T 3: 138,451,334 I219F probably damaging Het
Arhgap23 T A 11: 97,490,084 F1098I probably damaging Het
Bicc1 G T 10: 70,943,535 H674Q possibly damaging Het
Ccdc39 C T 3: 33,814,704 R786H probably benign Het
Ccr1l1 A G 9: 123,977,552 I286T possibly damaging Het
Ccr9 T A 9: 123,779,667 M138K probably benign Het
Dbh T C 2: 27,165,786 F91L probably benign Het
Dip2a T A 10: 76,274,281 probably null Het
Eif3j1 A G 2: 122,050,510 I148V probably damaging Het
Etl4 A G 2: 20,530,081 R116G probably damaging Het
Exoc6 C A 19: 37,608,992 Q614K possibly damaging Het
Gabpb1 A G 2: 126,652,274 S144P possibly damaging Het
Galnt13 G A 2: 55,060,476 V390M possibly damaging Het
Gimap5 T C 6: 48,752,567 S24P probably benign Het
Gm4778 A G 3: 94,266,555 N290S probably benign Het
Gm4924 T A 10: 82,377,867 probably benign Het
Gucy1a2 T A 9: 3,865,365 I613K probably damaging Het
Hsp90ab1 T A 17: 45,569,800 E115D probably benign Het
Hspg2 T C 4: 137,539,448 V1949A probably damaging Het
Ice2 A G 9: 69,411,416 Y294C probably damaging Het
Il17ra T G 6: 120,474,337 Y157* probably null Het
Ipo13 T C 4: 117,904,929 E416G probably damaging Het
Mmp17 A G 5: 129,602,207 D390G probably damaging Het
Mrps10 T G 17: 47,372,446 I102R probably damaging Het
Mycbp2 A G 14: 103,212,719 L1712P probably damaging Het
Nipal2 A G 15: 34,584,669 M251T probably damaging Het
Nup160 G A 2: 90,718,096 probably null Het
Olfr201 A T 16: 59,269,208 V153D probably benign Het
Olfr523 T C 7: 140,176,342 I74T probably damaging Het
Pdcd11 G A 19: 47,092,898 D34N possibly damaging Het
Pigb G T 9: 73,017,527 P450Q probably damaging Het
Radil A C 5: 142,488,501 L730R probably damaging Het
Rsbn1 G T 3: 103,914,222 probably benign Het
Sec24b T C 3: 130,011,818 D264G probably damaging Het
Shank3 C G 15: 89,547,770 S906C probably damaging Het
Slc1a3 A G 15: 8,642,975 V340A possibly damaging Het
Slc1a3 A T 15: 8,650,939 I145N possibly damaging Het
Slc35f4 A T 14: 49,304,224 S208T possibly damaging Het
Tmem132b A G 5: 125,638,316 D363G probably benign Het
Tox3 T G 8: 90,274,681 N34T probably damaging Het
Vmn1r231 T A 17: 20,889,739 I305L probably benign Het
Vps18 A G 2: 119,290,230 I57V possibly damaging Het
Zfhx4 T G 3: 5,399,543 L1587R probably damaging Het
Zfp112 A G 7: 24,125,897 N430S probably benign Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8118:Large1 UTSW 8 73131944 missense probably benign 0.40
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8963:Large1 UTSW 8 72815984 missense probably damaging 1.00
R9170:Large1 UTSW 8 72816017 missense probably benign 0.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACTTGTAGGTAGTGGCCATC -3'
(R):5'- TCTGTAAACACTGGGAGGGAC -3'

Sequencing Primer
(F):5'- TGGCAGACTAGACAATGGTCCTG -3'
(R):5'- AGGGACCCATCAGCCTG -3'
Posted On 2021-01-18