Incidental Mutation 'R8526:Snd1'
ID 658805
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Name staphylococcal nuclease and tudor domain containing 1
Synonyms p100 co-activator, Tudor-SN
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock # R8526 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 28475139-28935162 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28745254 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 533 (Y533H)
Ref Sequence ENSEMBL: ENSMUSP00000001460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]
AlphaFold Q78PY7
Predicted Effect probably benign
Transcript: ENSMUST00000001460
AA Change: Y533H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: Y533H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
AA Change: Y533H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424
AA Change: Y533H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171353
SMART Domains Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

DomainStartEndE-ValueType
low complexity region 29 39 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
Meta Mutation Damage Score 0.2755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,269,816 C706* probably null Het
4930522L14Rik T C 5: 109,737,789 I68V possibly damaging Het
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
Actr5 T G 2: 158,632,304 F342L probably damaging Het
Adamts13 T C 2: 26,978,000 V124A probably benign Het
Amotl1 T C 9: 14,562,196 E606G probably damaging Het
Carmil2 C T 8: 105,688,815 A265V probably damaging Het
Cdh22 T C 2: 165,112,258 E781G probably damaging Het
Dennd1b G A 1: 139,023,120 W33* probably null Het
Dlc1 C T 8: 36,937,814 V274I probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ect2l C T 10: 18,144,627 E582K probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Ift88 A T 14: 57,445,669 K40* probably null Het
Igkv4-72 A G 6: 69,227,156 V17A probably benign Het
Klhl28 T G 12: 64,951,626 T365P probably damaging Het
Krt16 T A 11: 100,246,483 Y434F probably benign Het
Lyst T A 13: 13,760,806 V3620E probably damaging Het
Mcm9 A T 10: 53,630,125 probably benign Het
Mef2a T C 7: 67,251,725 M100V possibly damaging Het
Mos T C 4: 3,871,709 K36E probably damaging Het
Ncapg2 T C 12: 116,440,059 Y864H probably benign Het
Olfr730 C T 14: 50,186,262 probably null Het
Olfr97 A G 17: 37,231,579 S264P probably damaging Het
Parp14 A T 16: 35,840,937 I1547N possibly damaging Het
Pcdh18 A T 3: 49,755,574 Y431N probably damaging Het
Phyhd1 T C 2: 30,266,943 probably null Het
Pkd2 T C 5: 104,489,236 F572L probably damaging Het
Rasgrf1 T A 9: 89,974,848 I453N probably damaging Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rrbp1 A G 2: 143,974,483 V742A probably benign Het
Serpinb3a A T 1: 107,048,774 probably null Het
Sgsm2 T G 11: 74,869,021 E97A probably benign Het
Smad4 A T 18: 73,657,259 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stk36 A G 1: 74,634,544 T1199A probably benign Het
Veph1 T A 3: 66,159,316 N417I probably benign Het
Vmn1r8 A G 6: 57,036,377 S138G probably benign Het
Vmn2r10 C T 5: 108,997,706 V512I possibly damaging Het
Zfp740 A G 15: 102,208,291 D47G probably null Het
Zfp810 T C 9: 22,278,290 K441E probably damaging Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28512986 critical splice donor site probably null
IGL00940:Snd1 APN 6 28745175 intron probably benign
IGL01340:Snd1 APN 6 28883369 missense probably benign
IGL01892:Snd1 APN 6 28888124 critical splice donor site probably null
IGL02063:Snd1 APN 6 28526221 unclassified probably benign
IGL02134:Snd1 APN 6 28880279 missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28707150 intron probably benign
PIT4677001:Snd1 UTSW 6 28880296 missense probably benign 0.01
R0039:Snd1 UTSW 6 28745210 missense probably damaging 1.00
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0463:Snd1 UTSW 6 28724956 missense probably benign 0.00
R0576:Snd1 UTSW 6 28886577 missense probably benign 0.31
R0709:Snd1 UTSW 6 28545470 splice site probably benign
R0959:Snd1 UTSW 6 28884971 missense probably benign 0.01
R1698:Snd1 UTSW 6 28888253 nonsense probably null
R1853:Snd1 UTSW 6 28545564 missense probably damaging 1.00
R2059:Snd1 UTSW 6 28745207 missense probably damaging 1.00
R2497:Snd1 UTSW 6 28888079 missense probably benign
R3832:Snd1 UTSW 6 28531404 splice site probably benign
R3833:Snd1 UTSW 6 28531404 splice site probably benign
R4643:Snd1 UTSW 6 28880249 missense probably benign 0.00
R4665:Snd1 UTSW 6 28707054 missense probably damaging 1.00
R4843:Snd1 UTSW 6 28668643 missense probably damaging 1.00
R4884:Snd1 UTSW 6 28526912 missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28884251 nonsense probably null
R4973:Snd1 UTSW 6 28884251 nonsense probably null
R5065:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5066:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5067:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5131:Snd1 UTSW 6 28885050 missense probably damaging 0.99
R5172:Snd1 UTSW 6 28886616 missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28545525 missense probably damaging 1.00
R5313:Snd1 UTSW 6 28668601 missense probably benign 0.15
R5395:Snd1 UTSW 6 28526184 missense probably damaging 0.99
R5938:Snd1 UTSW 6 28874859 critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28880234 missense probably benign 0.00
R6248:Snd1 UTSW 6 28520235 nonsense probably null
R6337:Snd1 UTSW 6 28888289 missense probably damaging 1.00
R6810:Snd1 UTSW 6 28668610 missense probably benign 0.23
R6932:Snd1 UTSW 6 28626101 missense probably benign 0.42
R7469:Snd1 UTSW 6 28626127 missense probably damaging 1.00
R7485:Snd1 UTSW 6 28531450 missense probably benign 0.14
R7571:Snd1 UTSW 6 28526203 missense possibly damaging 0.81
R7866:Snd1 UTSW 6 28527725 missense probably damaging 1.00
R8178:Snd1 UTSW 6 28874976 missense possibly damaging 0.85
R8208:Snd1 UTSW 6 28526055 missense possibly damaging 0.86
R8848:Snd1 UTSW 6 28874963 missense possibly damaging 0.72
R8854:Snd1 UTSW 6 28526969 missense probably benign 0.02
R9310:Snd1 UTSW 6 28795937 missense probably null 1.00
R9326:Snd1 UTSW 6 28795843 nonsense probably null
R9348:Snd1 UTSW 6 28745207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACAAATGAGCACCTATCTGTG -3'
(R):5'- CCCTCCATCTATGCAGGATGAG -3'

Sequencing Primer
(F):5'- TGCCCACTGCTCCGAAGAC -3'
(R):5'- CTCCATCTATGCAGGATGAGGTTCAG -3'
Posted On 2021-01-18