Incidental Mutation 'R8526:2210408I21Rik'
ID658823
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8526 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 77269816 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 706 (C706*)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect probably null
Transcript: ENSMUST00000168779
AA Change: C706*
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: C706*

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,789 I68V possibly damaging Het
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
Actr5 T G 2: 158,632,304 F342L probably damaging Het
Adamts13 T C 2: 26,978,000 V124A probably benign Het
Amotl1 T C 9: 14,562,196 E606G probably damaging Het
Carmil2 C T 8: 105,688,815 A265V probably damaging Het
Cdh22 T C 2: 165,112,258 E781G probably damaging Het
Dennd1b G A 1: 139,023,120 W33* probably null Het
Dlc1 C T 8: 36,937,814 V274I probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ect2l C T 10: 18,144,627 E582K probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Ift88 A T 14: 57,445,669 K40* probably null Het
Igkv4-72 A G 6: 69,227,156 V17A probably benign Het
Klhl28 T G 12: 64,951,626 T365P probably damaging Het
Krt16 T A 11: 100,246,483 Y434F probably benign Het
Lyst T A 13: 13,760,806 V3620E probably damaging Het
Mcm9 A T 10: 53,630,125 probably benign Het
Mef2a T C 7: 67,251,725 M100V possibly damaging Het
Mos T C 4: 3,871,709 K36E probably damaging Het
Ncapg2 T C 12: 116,440,059 Y864H probably benign Het
Olfr730 C T 14: 50,186,262 probably null Het
Olfr97 A G 17: 37,231,579 S264P probably damaging Het
Parp14 A T 16: 35,840,937 I1547N possibly damaging Het
Pcdh18 A T 3: 49,755,574 Y431N probably damaging Het
Phyhd1 T C 2: 30,266,943 probably null Het
Pkd2 T C 5: 104,489,236 F572L probably damaging Het
Rasgrf1 T A 9: 89,974,848 I453N probably damaging Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rrbp1 A G 2: 143,974,483 V742A probably benign Het
Serpinb3a A T 1: 107,048,774 probably null Het
Sgsm2 T G 11: 74,869,021 E97A probably benign Het
Smad4 A T 18: 73,657,259 probably null Het
Snd1 T C 6: 28,745,254 Y533H probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stk36 A G 1: 74,634,544 T1199A probably benign Het
Veph1 T A 3: 66,159,316 N417I probably benign Het
Vmn1r8 A G 6: 57,036,377 S138G probably benign Het
Vmn2r10 C T 5: 108,997,706 V512I possibly damaging Het
Zfp740 A G 15: 102,208,291 D47G probably null Het
Zfp810 T C 9: 22,278,290 K441E probably damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 splice site probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 splice site probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7963:2210408I21Rik UTSW 13 77192554 missense probably benign 0.02
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
R8170:2210408I21Rik UTSW 13 77263594 missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77193159 missense possibly damaging 0.72
R8255:2210408I21Rik UTSW 13 77267731 missense possibly damaging 0.71
R8296:2210408I21Rik UTSW 13 77267777 missense probably damaging 0.98
R8476:2210408I21Rik UTSW 13 77261901 missense possibly damaging 0.92
R8746:2210408I21Rik UTSW 13 77303410 missense probably benign 0.01
R8812:2210408I21Rik UTSW 13 77332352 missense probably damaging 0.98
R8870:2210408I21Rik UTSW 13 77323721 missense possibly damaging 0.96
R8885:2210408I21Rik UTSW 13 77323406 missense possibly damaging 0.91
R8910:2210408I21Rik UTSW 13 77323649 missense probably benign 0.03
R8911:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATCCATAGGCATTCAG -3'
(R):5'- ACTGAATGGGACCTACAGACAC -3'

Sequencing Primer
(F):5'- CCATCCATAGGCATTCAGTGGTG -3'
(R):5'- GCACATCAGAGTGACTAAATAGC -3'
Posted On2021-01-18