Incidental Mutation 'R8526:Ift88'
ID 658824
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Name intraflagellar transport 88
Synonyms Tg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8526 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57424062-57517936 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 57445669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 40 (K40*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000122063
AA Change: K268*
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040
AA Change: K268*

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171682
AA Change: K40*
SMART Domains Protein: ENSMUSP00000130475
Gene: ENSMUSG00000040040
AA Change: K40*

DomainStartEndE-ValueType
Pfam:DUF3808 1 164 2.7e-8 PFAM
Pfam:TPR_11 3 76 8.7e-11 PFAM
Pfam:TPR_12 3 77 3.8e-11 PFAM
Pfam:TPR_8 6 37 7e-4 PFAM
Pfam:TPR_2 7 38 1.8e-6 PFAM
Pfam:TPR_1 7 39 3.4e-9 PFAM
Pfam:TPR_7 8 41 1.9e-7 PFAM
Pfam:TPR_8 45 78 2.2e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,269,816 C706* probably null Het
4930522L14Rik T C 5: 109,737,789 I68V possibly damaging Het
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
Actr5 T G 2: 158,632,304 F342L probably damaging Het
Adamts13 T C 2: 26,978,000 V124A probably benign Het
Amotl1 T C 9: 14,562,196 E606G probably damaging Het
Carmil2 C T 8: 105,688,815 A265V probably damaging Het
Cdh22 T C 2: 165,112,258 E781G probably damaging Het
Dennd1b G A 1: 139,023,120 W33* probably null Het
Dlc1 C T 8: 36,937,814 V274I probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ect2l C T 10: 18,144,627 E582K probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Igkv4-72 A G 6: 69,227,156 V17A probably benign Het
Klhl28 T G 12: 64,951,626 T365P probably damaging Het
Krt16 T A 11: 100,246,483 Y434F probably benign Het
Lyst T A 13: 13,760,806 V3620E probably damaging Het
Mcm9 A T 10: 53,630,125 probably benign Het
Mef2a T C 7: 67,251,725 M100V possibly damaging Het
Mos T C 4: 3,871,709 K36E probably damaging Het
Ncapg2 T C 12: 116,440,059 Y864H probably benign Het
Olfr730 C T 14: 50,186,262 probably null Het
Olfr97 A G 17: 37,231,579 S264P probably damaging Het
Parp14 A T 16: 35,840,937 I1547N possibly damaging Het
Pcdh18 A T 3: 49,755,574 Y431N probably damaging Het
Phyhd1 T C 2: 30,266,943 probably null Het
Pkd2 T C 5: 104,489,236 F572L probably damaging Het
Rasgrf1 T A 9: 89,974,848 I453N probably damaging Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rrbp1 A G 2: 143,974,483 V742A probably benign Het
Serpinb3a A T 1: 107,048,774 probably null Het
Sgsm2 T G 11: 74,869,021 E97A probably benign Het
Smad4 A T 18: 73,657,259 probably null Het
Snd1 T C 6: 28,745,254 Y533H probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stk36 A G 1: 74,634,544 T1199A probably benign Het
Veph1 T A 3: 66,159,316 N417I probably benign Het
Vmn1r8 A G 6: 57,036,377 S138G probably benign Het
Vmn2r10 C T 5: 108,997,706 V512I possibly damaging Het
Zfp740 A G 15: 102,208,291 D47G probably null Het
Zfp810 T C 9: 22,278,290 K441E probably damaging Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0392:Ift88 UTSW 14 57496160 splice site probably benign
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R3815:Ift88 UTSW 14 57440981 missense possibly damaging 0.88
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4704:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6602:Ift88 UTSW 14 57507259 missense probably benign 0.00
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7241:Ift88 UTSW 14 57479997 missense probably damaging 0.97
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
R7736:Ift88 UTSW 14 57445664 missense probably benign 0.18
R7766:Ift88 UTSW 14 57447654 missense possibly damaging 0.65
R9018:Ift88 UTSW 14 57438245 missense probably benign 0.20
R9289:Ift88 UTSW 14 57480742 missense probably benign
R9340:Ift88 UTSW 14 57481463 missense probably damaging 1.00
R9369:Ift88 UTSW 14 57447680 missense probably benign 0.10
R9399:Ift88 UTSW 14 57479928 missense probably benign 0.00
R9485:Ift88 UTSW 14 57438267 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATAAGTCTCATGCACGAGC -3'
(R):5'- TGTGTGCAAACAGACACAGGTG -3'

Sequencing Primer
(F):5'- TTAGTCCCCAGATCCTAGAAAGTGG -3'
(R):5'- GTGAACAGAGCAAAATACCACATCTG -3'
Posted On 2021-01-18