Incidental Mutation 'R8527:Apmap'
ID658840
Institutional Source Beutler Lab
Gene Symbol Apmap
Ensembl Gene ENSMUSG00000033096
Gene Nameadipocyte plasma membrane associated protein
Synonyms2310001A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8527 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150583080-150608567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150586465 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 254 (Q254R)
Ref Sequence ENSEMBL: ENSMUSP00000040840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046399]
Predicted Effect probably benign
Transcript: ENSMUST00000046399
AA Change: Q254R

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040840
Gene: ENSMUSG00000033096
AA Change: Q254R

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Pfam:SGL 101 327 1.4e-17 PFAM
Pfam:Str_synth 200 288 1.2e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,309,888 probably null Het
Acsl5 A G 19: 55,291,827 T511A probably damaging Het
Ankrd35 A G 3: 96,682,037 I191V probably damaging Het
Arhgef12 A T 9: 42,997,648 L661Q possibly damaging Het
Atf7ip2 T A 16: 10,237,265 probably benign Het
Braf T C 6: 39,627,759 H592R probably benign Het
Ceacam2 T A 7: 25,538,730 I90L probably benign Het
Dgcr6 T C 16: 18,069,526 probably null Het
Efcab12 T C 6: 115,814,574 I546V probably benign Het
Eya1 G T 1: 14,252,448 A268E probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Gas6 T C 8: 13,465,790 I661V probably damaging Het
Gipc3 T A 10: 81,338,221 M240L possibly damaging Het
Gm12689 A G 4: 99,296,213 D101G unknown Het
Kctd2 G T 11: 115,429,484 probably benign Het
Kdm5b A T 1: 134,605,774 M534L possibly damaging Het
Kif14 T A 1: 136,468,757 V267D possibly damaging Het
Lca5l C A 16: 96,159,238 G675C probably damaging Het
Lmod1 T C 1: 135,364,483 F359L possibly damaging Het
Lonrf1 G T 8: 36,219,832 N783K possibly damaging Het
Megf10 T C 18: 57,292,718 S1059P probably benign Het
Mmp24 A G 2: 155,799,714 E154G probably benign Het
Mtus2 A C 5: 148,303,598 K85T probably damaging Het
Myh11 T C 16: 14,230,706 H586R probably damaging Het
Noc2l A G 4: 156,241,730 T425A probably benign Het
Olfm3 A T 3: 115,122,547 Q376L probably benign Het
Pax5 A T 4: 44,570,071 Y272N probably damaging Het
Rasgrp1 A T 2: 117,338,304 D64E probably benign Het
Rb1cc1 T A 1: 6,244,875 N417K probably damaging Het
Rpl3l A G 17: 24,735,780 D369G probably damaging Het
Scn3a G T 2: 65,497,519 H876N probably damaging Het
Slc29a3 A G 10: 60,730,622 S111P probably damaging Het
Smarca2 G C 19: 26,676,787 V791L probably damaging Het
Smc4 T A 3: 69,032,891 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tanc2 A G 11: 105,917,008 E1288G probably damaging Het
Tex52 G A 6: 128,379,865 V174I probably benign Het
Tjp2 C A 19: 24,111,573 G660W probably damaging Het
Tmem121b T C 6: 120,492,094 E554G probably damaging Het
Tmem209 C A 6: 30,497,238 V318F probably damaging Het
Tnxb A G 17: 34,688,660 E1226G probably damaging Het
Traf3ip3 T A 1: 193,194,543 I196F probably damaging Het
Trpc4ap G C 2: 155,692,212 P32R unknown Het
Vav3 A G 3: 109,503,471 K206R probably damaging Het
Zan T C 5: 137,435,709 E2254G unknown Het
Other mutations in Apmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03135:Apmap APN 2 150587115 missense possibly damaging 0.89
R0898:Apmap UTSW 2 150585749 splice site probably benign
R2267:Apmap UTSW 2 150588901 critical splice donor site probably null
R4171:Apmap UTSW 2 150584067 missense probably benign 0.01
R5456:Apmap UTSW 2 150590069 missense probably benign 0.00
R5815:Apmap UTSW 2 150600251 missense probably benign 0.00
R5838:Apmap UTSW 2 150585857 missense probably damaging 1.00
R5846:Apmap UTSW 2 150608421 missense probably damaging 0.99
R6117:Apmap UTSW 2 150600332 missense probably benign 0.13
R6899:Apmap UTSW 2 150594308 missense probably benign 0.07
R8542:Apmap UTSW 2 150586465 missense probably benign 0.21
R8734:Apmap UTSW 2 150588904 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTTGCAAAGGCTGAGACATAAG -3'
(R):5'- CAGCCACGTAGATTGATGACTTG -3'

Sequencing Primer
(F):5'- CTCATCATTACATAGACAGGAGGTG -3'
(R):5'- ATGACTTGGGTTTTATCACTCCAG -3'
Posted On2021-01-18