Mutagenetix > Incidental Mutation

Incidental Mutation 'R8527:Megf10'

658872

Institutional Source

Beutler Lab

Gene Symbol

Megf10

Ensembl Gene

ENSMUSG00000024593

Gene Name

multiple EGF-like-domains 10

Synonyms

3000002B06Rik, LOC240312

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R8527 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57133090-57297467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57292718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1059 (S1059P)

Ref Sequence

ENSEMBL: ENSMUSP00000116814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]

AlphaFold

Q6DIB5

Predicted Effect

probably benign
Transcript: ENSMUST00000075770
AA Change: S1059P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: S1059P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC
low complexity region	1131	1146	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139892
AA Change: S1059P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: S1059P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,309,888		probably null	Het
Acsl5	A	G	19: 55,291,827	T511A	probably damaging	Het
Ankrd35	A	G	3: 96,682,037	I191V	probably damaging	Het
Apmap	T	C	2: 150,586,465	Q254R	probably benign	Het
Arhgef12	A	T	9: 42,997,648	L661Q	possibly damaging	Het
Atf7ip2	T	A	16: 10,237,265		probably benign	Het
Braf	T	C	6: 39,627,759	H592R	probably benign	Het
Ceacam2	T	A	7: 25,538,730	I90L	probably benign	Het
Dgcr6	T	C	16: 18,069,526		probably null	Het
Efcab12	T	C	6: 115,814,574	I546V	probably benign	Het
Eya1	G	T	1: 14,252,448	A268E	probably damaging	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Gas6	T	C	8: 13,465,790	I661V	probably damaging	Het
Gipc3	T	A	10: 81,338,221	M240L	possibly damaging	Het
Gm12689	A	G	4: 99,296,213	D101G	unknown	Het
Kctd2	G	T	11: 115,429,484		probably benign	Het
Kdm5b	A	T	1: 134,605,774	M534L	possibly damaging	Het
Kif14	T	A	1: 136,468,757	V267D	possibly damaging	Het
Lca5l	C	A	16: 96,159,238	G675C	probably damaging	Het
Lmod1	T	C	1: 135,364,483	F359L	possibly damaging	Het
Lonrf1	G	T	8: 36,219,832	N783K	possibly damaging	Het
Mmp24	A	G	2: 155,799,714	E154G	probably benign	Het
Mtus2	A	C	5: 148,303,598	K85T	probably damaging	Het
Myh11	T	C	16: 14,230,706	H586R	probably damaging	Het
Noc2l	A	G	4: 156,241,730	T425A	probably benign	Het
Olfm3	A	T	3: 115,122,547	Q376L	probably benign	Het
Pax5	A	T	4: 44,570,071	Y272N	probably damaging	Het
Rasgrp1	A	T	2: 117,338,304	D64E	probably benign	Het
Rb1cc1	T	A	1: 6,244,875	N417K	probably damaging	Het
Rpl3l	A	G	17: 24,735,780	D369G	probably damaging	Het
Scn3a	G	T	2: 65,497,519	H876N	probably damaging	Het
Slc29a3	A	G	10: 60,730,622	S111P	probably damaging	Het
Smarca2	G	C	19: 26,676,787	V791L	probably damaging	Het
Smc4	T	A	3: 69,032,891		probably null	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Tanc2	A	G	11: 105,917,008	E1288G	probably damaging	Het
Tex52	G	A	6: 128,379,865	V174I	probably benign	Het
Tjp2	C	A	19: 24,111,573	G660W	probably damaging	Het
Tmem121b	T	C	6: 120,492,094	E554G	probably damaging	Het
Tmem209	C	A	6: 30,497,238	V318F	probably damaging	Het
Tnxb	A	G	17: 34,688,660	E1226G	probably damaging	Het
Traf3ip3	T	A	1: 193,194,543	I196F	probably damaging	Het
Trpc4ap	G	C	2: 155,692,212	P32R	unknown	Het
Vav3	A	G	3: 109,503,471	K206R	probably damaging	Het
Zan	T	C	5: 137,435,709	E2254G	unknown	Het

Other mutations in Megf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Megf10	APN	18	57240628	missense	probably damaging	1.00
IGL00736:Megf10	APN	18	57292710	missense	probably benign	0.35
IGL01631:Megf10	APN	18	57259797	missense	possibly damaging	0.61
IGL02488:Megf10	APN	18	57292632	missense	probably damaging	1.00
IGL02747:Megf10	APN	18	57290493	missense	probably benign	0.43
IGL03298:Megf10	APN	18	57283838	nonsense	probably null
deep	UTSW	18	57262131	missense	probably damaging	1.00
megalodon	UTSW	18	57287976	nonsense	probably null
sharkie	UTSW	18	57191185	nonsense	probably null
IGL03046:Megf10	UTSW	18	57287983	missense	possibly damaging	0.95
PIT4696001:Megf10	UTSW	18	57277688	missense	probably damaging	1.00
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0115:Megf10	UTSW	18	57259802	missense	possibly damaging	0.67
R0455:Megf10	UTSW	18	57252982	missense	probably benign	0.34
R0602:Megf10	UTSW	18	57262100	missense	probably damaging	0.98
R0630:Megf10	UTSW	18	57287995	missense	probably benign	0.14
R0652:Megf10	UTSW	18	57277724	missense	probably benign	0.00
R0658:Megf10	UTSW	18	57252896	missense	probably benign	0.00
R0761:Megf10	UTSW	18	57287976	nonsense	probably null
R1013:Megf10	UTSW	18	57261219	missense	probably benign	0.00
R1130:Megf10	UTSW	18	57262006	missense	probably benign	0.06
R1451:Megf10	UTSW	18	57252859	missense	probably damaging	0.97
R1699:Megf10	UTSW	18	57277730	splice site	probably null
R1729:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1784:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1870:Megf10	UTSW	18	57191185	nonsense	probably null
R1961:Megf10	UTSW	18	57212354	missense	probably damaging	0.97
R2094:Megf10	UTSW	18	57281713	nonsense	probably null
R2213:Megf10	UTSW	18	57288009	nonsense	probably null
R2853:Megf10	UTSW	18	57293931	missense	probably damaging	1.00
R3772:Megf10	UTSW	18	57283862	missense	probably benign	0.39
R3774:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3775:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3776:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3858:Megf10	UTSW	18	57275835	splice site	probably benign
R3911:Megf10	UTSW	18	57289393	missense	probably damaging	0.99
R3966:Megf10	UTSW	18	57180574	missense	probably damaging	1.00
R4043:Megf10	UTSW	18	57259798	missense	probably damaging	0.98
R4131:Megf10	UTSW	18	57180535	missense	probably damaging	1.00
R4598:Megf10	UTSW	18	57189603	critical splice donor site	probably null
R4598:Megf10	UTSW	18	57287812	missense	probably damaging	1.00
R4726:Megf10	UTSW	18	57287792	missense	probably benign	0.32
R4765:Megf10	UTSW	18	57287794	missense	possibly damaging	0.56
R4874:Megf10	UTSW	18	57293858	missense	probably benign	0.00
R4928:Megf10	UTSW	18	57240673	missense	probably benign
R5412:Megf10	UTSW	18	57191147	missense	probably damaging	0.99
R5901:Megf10	UTSW	18	57277108	missense	probably benign	0.11
R6015:Megf10	UTSW	18	57253028	missense	probably benign	0.01
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6041:Megf10	UTSW	18	57180549	missense	probably benign
R6369:Megf10	UTSW	18	57261187	missense	probably benign	0.06
R6479:Megf10	UTSW	18	57246570	missense	possibly damaging	0.76
R6489:Megf10	UTSW	18	57291807	missense	probably benign	0.01
R7228:Megf10	UTSW	18	57189589	missense	probably damaging	1.00
R7296:Megf10	UTSW	18	57275753	missense	probably damaging	1.00
R7437:Megf10	UTSW	18	57262131	missense	probably damaging	1.00
R7461:Megf10	UTSW	18	57252853	missense	probably damaging	0.98
R7488:Megf10	UTSW	18	57191115	missense	probably damaging	0.99
R7492:Megf10	UTSW	18	57291794	missense	probably benign	0.00
R7542:Megf10	UTSW	18	57189570	missense	probably benign	0.07
R7636:Megf10	UTSW	18	57276989	missense	possibly damaging	0.85
R7646:Megf10	UTSW	18	57293999	unclassified	probably benign
R7650:Megf10	UTSW	18	57293999	unclassified	probably benign
R7713:Megf10	UTSW	18	57293999	unclassified	probably benign
R7714:Megf10	UTSW	18	57293999	unclassified	probably benign
R7716:Megf10	UTSW	18	57293999	unclassified	probably benign
R7796:Megf10	UTSW	18	57277659	missense	possibly damaging	0.85
R7915:Megf10	UTSW	18	57240735	missense	probably benign	0.05
R8221:Megf10	UTSW	18	57283821	missense	probably benign	0.00
R8559:Megf10	UTSW	18	57240627	missense	probably damaging	1.00
R9117:Megf10	UTSW	18	57259701	missense	probably damaging	1.00
R9337:Megf10	UTSW	18	57261180	nonsense	probably null
R9481:Megf10	UTSW	18	57262018	missense	probably benign	0.38
R9644:Megf10	UTSW	18	57242701	missense	probably benign
RF003:Megf10	UTSW	18	57294027	unclassified	probably benign
Z1176:Megf10	UTSW	18	57277694	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GATGTCGCCCGTGAAACTAC -3'
(R):5'- TGATGGCCATGTGGAAGAC -3'

Sequencing Primer
(F):5'- GCCCGTGAAACTACACTTATTC -3'
(R):5'- GAGACATTCATTTCCCATCAGTTG -3'

Posted On

2021-01-18