Incidental Mutation 'R8528:Cfap65'
ID 658880
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock # R8528 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74905937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1442 (V1442A)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect possibly damaging
Transcript: ENSMUST00000094844
AA Change: V1442A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: V1442A

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,575,851 I169L possibly damaging Het
Ahnak A T 19: 9,007,728 K2125N probably damaging Het
Arl5b T A 2: 15,073,327 probably null Het
BC055324 T C 1: 163,986,083 K191E probably damaging Het
Ccng2 T C 5: 93,269,305 V60A possibly damaging Het
Cyp1b1 T A 17: 79,710,564 E387D probably damaging Het
Dchs2 T C 3: 83,354,611 S2729P probably damaging Het
Dnah11 A G 12: 118,008,803 F2882S probably damaging Het
Dpy30 T C 17: 74,299,762 D97G probably benign Het
Enam T A 5: 88,502,219 V454E probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Ero1lb T A 13: 12,599,868 C240* probably null Het
Exog A G 9: 119,462,620 D297G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fer1l5 A G 1: 36,417,774 Y1611C possibly damaging Het
Frmpd1 T C 4: 45,285,034 V1285A probably benign Het
Gfpt1 G C 6: 87,066,788 probably null Het
Gm15446 T C 5: 109,943,030 Y383H possibly damaging Het
Gsdmc A T 15: 63,777,340 probably null Het
Hao1 A G 2: 134,522,993 I238T probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kcnv2 T A 19: 27,322,987 D79E probably benign Het
Lrrc8a T C 2: 30,255,545 Y124H probably damaging Het
Lrrc8d T A 5: 105,812,486 M254K probably benign Het
Map3k4 T C 17: 12,232,934 N1489S probably damaging Het
Mapk8ip2 A G 15: 89,455,219 D34G probably damaging Het
Myo9a A G 9: 59,860,140 T876A probably damaging Het
Pabpc2 C T 18: 39,775,386 T568I probably benign Het
Pcdhga2 G T 18: 37,669,168 A22S probably benign Het
Rc3h2 G A 2: 37,382,799 T755I probably benign Het
Sertad4 A G 1: 192,851,083 V15A probably benign Het
Slc28a2 A G 2: 122,455,742 K520E probably damaging Het
Slc4a10 T C 2: 62,296,796 V831A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Sprn C T 7: 140,153,510 probably benign Het
Stim1 T C 7: 102,431,082 probably benign Het
Stk24 C A 14: 121,292,035 A402S probably benign Het
Sycp2 A G 2: 178,374,533 L712P probably damaging Het
Tenm3 C T 8: 48,342,633 G269S probably damaging Het
Zdbf2 A G 1: 63,303,386 E308G possibly damaging Het
Zfp442 A C 2: 150,409,042 H312Q probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTTGAGCCCTTCCAAG -3'
(R):5'- AGCCTCATTCTGTACAGCCC -3'

Sequencing Primer
(F):5'- AAGGGTTTGCAGACCTCA -3'
(R):5'- GCCCAGCCTATCCTAGTACATC -3'
Posted On 2021-01-18