Incidental Mutation 'R8528:Dchs2'
ID658890
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Namedachsous cadherin related 2
SynonymsLOC229459
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R8528 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83127948-83357209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83354611 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2729 (S2729P)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
Predicted Effect probably damaging
Transcript: ENSMUST00000191829
AA Change: S2729P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: S2729P

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,575,851 I169L possibly damaging Het
Ahnak A T 19: 9,007,728 K2125N probably damaging Het
Arl5b T A 2: 15,073,327 probably null Het
BC055324 T C 1: 163,986,083 K191E probably damaging Het
Ccng2 T C 5: 93,269,305 V60A possibly damaging Het
Cfap65 A G 1: 74,905,937 V1442A possibly damaging Het
Cyp1b1 T A 17: 79,710,564 E387D probably damaging Het
Dnah11 A G 12: 118,008,803 F2882S probably damaging Het
Dpy30 T C 17: 74,299,762 D97G probably benign Het
Enam T A 5: 88,502,219 V454E probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Ero1lb T A 13: 12,599,868 C240* probably null Het
Exog A G 9: 119,462,620 D297G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fer1l5 A G 1: 36,417,774 Y1611C possibly damaging Het
Frmpd1 T C 4: 45,285,034 V1285A probably benign Het
Gfpt1 G C 6: 87,066,788 probably null Het
Gm15446 T C 5: 109,943,030 Y383H possibly damaging Het
Gsdmc A T 15: 63,777,340 probably null Het
Hao1 A G 2: 134,522,993 I238T probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kcnv2 T A 19: 27,322,987 D79E probably benign Het
Lrrc8a T C 2: 30,255,545 Y124H probably damaging Het
Lrrc8d T A 5: 105,812,486 M254K probably benign Het
Map3k4 T C 17: 12,232,934 N1489S probably damaging Het
Mapk8ip2 A G 15: 89,455,219 D34G probably damaging Het
Myo9a A G 9: 59,860,140 T876A probably damaging Het
Pabpc2 C T 18: 39,775,386 T568I probably benign Het
Pcdhga2 G T 18: 37,669,168 A22S probably benign Het
Rc3h2 G A 2: 37,382,799 T755I probably benign Het
Sertad4 A G 1: 192,851,083 V15A probably benign Het
Slc28a2 A G 2: 122,455,742 K520E probably damaging Het
Slc4a10 T C 2: 62,296,796 V831A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Sprn C T 7: 140,153,510 probably benign Het
Stim1 T C 7: 102,431,082 probably benign Het
Stk24 C A 14: 121,292,035 A402S probably benign Het
Sycp2 A G 2: 178,374,533 L712P probably damaging Het
Tenm3 C T 8: 48,342,633 G269S probably damaging Het
Zdbf2 A G 1: 63,303,386 E308G possibly damaging Het
Zfp442 A C 2: 150,409,042 H312Q probably damaging Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83127605 unclassified probably benign
R5857:Dchs2 UTSW 3 83270313 missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83285410 missense possibly damaging 0.95
R5959:Dchs2 UTSW 3 83325418 missense probably benign 0.01
R6007:Dchs2 UTSW 3 83346227 missense probably damaging 0.99
R6054:Dchs2 UTSW 3 83346236 missense probably benign 0.00
R6059:Dchs2 UTSW 3 83355736 missense probably benign 0.06
R6075:Dchs2 UTSW 3 83355061 missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83355146 missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83129911 missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83354263 missense probably benign 0.01
R6432:Dchs2 UTSW 3 83271118 missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83269270 missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83129169 missense probably benign 0.04
R6798:Dchs2 UTSW 3 83348286 missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83128534 missense probably benign 0.00
R6855:Dchs2 UTSW 3 83348194 missense probably benign 0.08
R6956:Dchs2 UTSW 3 83353926 missense probably benign 0.00
R7090:Dchs2 UTSW 3 83348274 missense probably benign 0.03
R7249:Dchs2 UTSW 3 83128029 nonsense probably null
R7252:Dchs2 UTSW 3 83325303 missense probably benign 0.04
R7462:Dchs2 UTSW 3 83346155 splice site probably null
R7482:Dchs2 UTSW 3 83248725 missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83356306 missense probably damaging 0.99
R7529:Dchs2 UTSW 3 83354398 missense possibly damaging 0.89
R7542:Dchs2 UTSW 3 83269284 missense probably benign 0.16
R7544:Dchs2 UTSW 3 83355127 missense probably damaging 1.00
R7547:Dchs2 UTSW 3 83356127 missense probably damaging 0.96
R7587:Dchs2 UTSW 3 83304515 missense probably benign
R7632:Dchs2 UTSW 3 83348050 missense probably benign 0.00
R7694:Dchs2 UTSW 3 83129482 missense probably damaging 1.00
R7701:Dchs2 UTSW 3 83346206 missense possibly damaging 0.83
R7746:Dchs2 UTSW 3 83128057 missense possibly damaging 0.94
R7838:Dchs2 UTSW 3 83304527 missense probably benign 0.01
R7886:Dchs2 UTSW 3 83305085 missense probably damaging 1.00
R8055:Dchs2 UTSW 3 83129725 missense probably benign 0.00
R8068:Dchs2 UTSW 3 83300438 missense probably benign 0.12
R8094:Dchs2 UTSW 3 83355622 missense probably benign 0.02
R8160:Dchs2 UTSW 3 83270805 missense probably benign 0.19
R8166:Dchs2 UTSW 3 83354333 missense probably benign 0.28
R8278:Dchs2 UTSW 3 83271003 missense probably damaging 1.00
R8422:Dchs2 UTSW 3 83325263 missense probably benign 0.30
R8506:Dchs2 UTSW 3 83301174 missense probably benign 0.17
R8517:Dchs2 UTSW 3 83271112 missense probably damaging 0.96
R8693:Dchs2 UTSW 3 83285324 missense probably damaging 1.00
R8708:Dchs2 UTSW 3 83128742 missense probably benign 0.00
R8757:Dchs2 UTSW 3 83354260 missense possibly damaging 0.96
R8768:Dchs2 UTSW 3 83346285 missense probably benign 0.12
R8776:Dchs2 UTSW 3 83356394 missense possibly damaging 0.46
R8776-TAIL:Dchs2 UTSW 3 83356394 missense possibly damaging 0.46
R8802:Dchs2 UTSW 3 83346237 missense probably benign 0.01
R8821:Dchs2 UTSW 3 83285363 missense probably benign 0.00
RF012:Dchs2 UTSW 3 83355068 missense probably benign 0.03
Z1177:Dchs2 UTSW 3 83271140 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGGTATCGGCAGATGACCCTG -3'
(R):5'- ATGCATCCCGTGTGTGACAAG -3'

Sequencing Primer
(F):5'- GCAGATGACCCTGACAAAGGTTC -3'
(R):5'- GGTGACACAATAGAGTAAGTCACCTC -3'
Posted On2021-01-18