Incidental Mutation 'R8528:Spag17'
ID 658891
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Name sperm associated antigen 17
Synonyms PF6, 4931427F14Rik
MMRRC Submission 068498-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8528 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99792722-100050638 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100031501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2255 (I2255F)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
AlphaFold Q5S003
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: I2255F

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: I2255F

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,447,700 (GRCm39) I169L possibly damaging Het
Ahnak A T 19: 8,985,092 (GRCm39) K2125N probably damaging Het
Arl5b T A 2: 15,078,138 (GRCm39) probably null Het
Ccng2 T C 5: 93,417,164 (GRCm39) V60A possibly damaging Het
Cfap65 A G 1: 74,945,096 (GRCm39) V1442A possibly damaging Het
Cyp1b1 T A 17: 80,017,993 (GRCm39) E387D probably damaging Het
Dchs2 T C 3: 83,261,918 (GRCm39) S2729P probably damaging Het
Dnah11 A G 12: 117,972,538 (GRCm39) F2882S probably damaging Het
Dpy30 T C 17: 74,606,757 (GRCm39) D97G probably benign Het
Enam T A 5: 88,650,078 (GRCm39) V454E probably damaging Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Ero1b T A 13: 12,614,757 (GRCm39) C240* probably null Het
Exog A G 9: 119,291,686 (GRCm39) D297G probably damaging Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
Fer1l5 A G 1: 36,456,855 (GRCm39) Y1611C possibly damaging Het
Firrm T C 1: 163,813,652 (GRCm39) K191E probably damaging Het
Frmpd1 T C 4: 45,285,034 (GRCm39) V1285A probably benign Het
Gfpt1 G C 6: 87,043,770 (GRCm39) probably null Het
Gm15446 T C 5: 110,090,896 (GRCm39) Y383H possibly damaging Het
Gsdmc A T 15: 63,649,189 (GRCm39) probably null Het
Hao1 A G 2: 134,364,913 (GRCm39) I238T probably damaging Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kcnv2 T A 19: 27,300,387 (GRCm39) D79E probably benign Het
Lrrc8a T C 2: 30,145,557 (GRCm39) Y124H probably damaging Het
Lrrc8d T A 5: 105,960,352 (GRCm39) M254K probably benign Het
Map3k4 T C 17: 12,451,821 (GRCm39) N1489S probably damaging Het
Mapk8ip2 A G 15: 89,339,422 (GRCm39) D34G probably damaging Het
Myo9a A G 9: 59,767,423 (GRCm39) T876A probably damaging Het
Pabpc2 C T 18: 39,908,439 (GRCm39) T568I probably benign Het
Pcdhga2 G T 18: 37,802,221 (GRCm39) A22S probably benign Het
Rc3h2 G A 2: 37,272,811 (GRCm39) T755I probably benign Het
Sertad4 A G 1: 192,533,391 (GRCm39) V15A probably benign Het
Slc28a2 A G 2: 122,286,223 (GRCm39) K520E probably damaging Het
Slc4a10 T C 2: 62,127,140 (GRCm39) V831A possibly damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Sprn C T 7: 139,733,423 (GRCm39) probably benign Het
Stim1 T C 7: 102,080,289 (GRCm39) probably benign Het
Stk24 C A 14: 121,529,447 (GRCm39) A402S probably benign Het
Sycp2 A G 2: 178,016,326 (GRCm39) L712P probably damaging Het
Tenm3 C T 8: 48,795,668 (GRCm39) G269S probably damaging Het
Zdbf2 A G 1: 63,342,545 (GRCm39) E308G possibly damaging Het
Zfp442 A C 2: 150,250,962 (GRCm39) H312Q probably damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 99,970,691 (GRCm39) missense probably benign 0.00
IGL01143:Spag17 APN 3 99,846,614 (GRCm39) missense probably benign 0.00
IGL01329:Spag17 APN 3 100,002,865 (GRCm39) missense probably benign 0.16
IGL01393:Spag17 APN 3 99,934,926 (GRCm39) missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100,016,824 (GRCm39) missense possibly damaging 0.65
IGL01705:Spag17 APN 3 99,930,046 (GRCm39) missense probably benign 0.01
IGL01928:Spag17 APN 3 99,847,390 (GRCm39) splice site probably benign
IGL01981:Spag17 APN 3 99,966,149 (GRCm39) missense probably benign 0.03
IGL02435:Spag17 APN 3 99,889,760 (GRCm39) missense possibly damaging 0.53
IGL02452:Spag17 APN 3 99,934,707 (GRCm39) missense probably benign 0.00
IGL02465:Spag17 APN 3 99,983,187 (GRCm39) missense probably damaging 0.96
IGL02615:Spag17 APN 3 99,979,401 (GRCm39) missense probably benign 0.09
IGL02751:Spag17 APN 3 99,918,110 (GRCm39) nonsense probably null
IGL02803:Spag17 APN 3 100,016,713 (GRCm39) missense probably benign
IGL02898:Spag17 APN 3 100,008,702 (GRCm39) missense probably benign 0.00
IGL03037:Spag17 APN 3 99,979,486 (GRCm39) splice site probably null
IGL03068:Spag17 APN 3 99,987,521 (GRCm39) missense probably benign 0.35
IGL03131:Spag17 APN 3 99,918,075 (GRCm39) missense possibly damaging 0.85
IGL03224:Spag17 APN 3 99,918,156 (GRCm39) missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 99,963,568 (GRCm39) small insertion probably benign
FR4342:Spag17 UTSW 3 99,963,565 (GRCm39) small insertion probably benign
FR4548:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,574 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,561 (GRCm39) small insertion probably benign
FR4737:Spag17 UTSW 3 99,963,573 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,571 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
N/A:Spag17 UTSW 3 99,889,570 (GRCm39) splice site probably benign
PIT4504001:Spag17 UTSW 3 100,010,426 (GRCm39) critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 99,920,527 (GRCm39) missense possibly damaging 0.53
R0107:Spag17 UTSW 3 99,958,103 (GRCm39) missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100,014,143 (GRCm39) missense probably benign 0.08
R0243:Spag17 UTSW 3 99,992,684 (GRCm39) missense probably benign 0.04
R0321:Spag17 UTSW 3 100,008,719 (GRCm39) missense probably damaging 0.99
R0375:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R0417:Spag17 UTSW 3 99,972,870 (GRCm39) missense probably benign 0.11
R0490:Spag17 UTSW 3 99,889,727 (GRCm39) missense probably damaging 0.97
R0537:Spag17 UTSW 3 100,032,618 (GRCm39) missense probably damaging 0.98
R0714:Spag17 UTSW 3 99,987,472 (GRCm39) missense probably damaging 0.97
R0844:Spag17 UTSW 3 99,912,101 (GRCm39) missense probably benign
R0919:Spag17 UTSW 3 99,979,259 (GRCm39) splice site probably benign
R0926:Spag17 UTSW 3 99,979,432 (GRCm39) missense probably benign
R1037:Spag17 UTSW 3 100,010,433 (GRCm39) missense probably benign 0.01
R1075:Spag17 UTSW 3 100,000,992 (GRCm39) missense probably damaging 0.99
R1109:Spag17 UTSW 3 99,934,667 (GRCm39) missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100,002,954 (GRCm39) missense probably benign 0.01
R1221:Spag17 UTSW 3 99,889,584 (GRCm39) missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99,846,679 (GRCm39) missense possibly damaging 0.73
R1586:Spag17 UTSW 3 99,929,068 (GRCm39) missense possibly damaging 0.53
R1768:Spag17 UTSW 3 99,934,668 (GRCm39) missense possibly damaging 0.53
R1782:Spag17 UTSW 3 99,918,070 (GRCm39) missense probably benign 0.02
R1789:Spag17 UTSW 3 99,846,672 (GRCm39) missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99,847,298 (GRCm39) missense probably benign
R2065:Spag17 UTSW 3 99,920,524 (GRCm39) missense probably benign 0.03
R2118:Spag17 UTSW 3 99,956,556 (GRCm39) missense possibly damaging 0.72
R2265:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2266:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2267:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2268:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2271:Spag17 UTSW 3 100,014,113 (GRCm39) missense probably damaging 1.00
R2389:Spag17 UTSW 3 100,014,153 (GRCm39) missense probably benign 0.27
R2420:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2422:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2423:Spag17 UTSW 3 100,010,772 (GRCm39) missense probably benign
R3407:Spag17 UTSW 3 99,992,615 (GRCm39) missense probably benign 0.09
R3801:Spag17 UTSW 3 99,961,169 (GRCm39) missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100,014,075 (GRCm39) missense probably damaging 1.00
R4021:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4022:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4408:Spag17 UTSW 3 100,010,694 (GRCm39) missense probably benign
R4468:Spag17 UTSW 3 99,992,682 (GRCm39) missense probably damaging 0.98
R4540:Spag17 UTSW 3 99,995,697 (GRCm39) missense probably damaging 1.00
R4621:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4622:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4756:Spag17 UTSW 3 100,010,701 (GRCm39) missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99,891,795 (GRCm39) missense possibly damaging 0.70
R4855:Spag17 UTSW 3 99,970,649 (GRCm39) missense probably benign 0.02
R4887:Spag17 UTSW 3 99,958,147 (GRCm39) missense probably damaging 1.00
R4962:Spag17 UTSW 3 99,934,939 (GRCm39) missense probably benign
R5030:Spag17 UTSW 3 99,992,657 (GRCm39) nonsense probably null
R5042:Spag17 UTSW 3 99,979,465 (GRCm39) missense probably damaging 1.00
R5074:Spag17 UTSW 3 99,987,434 (GRCm39) missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100,008,704 (GRCm39) missense probably benign 0.16
R5200:Spag17 UTSW 3 99,970,787 (GRCm39) nonsense probably null
R5267:Spag17 UTSW 3 99,969,264 (GRCm39) missense probably damaging 0.98
R5360:Spag17 UTSW 3 100,016,726 (GRCm39) missense probably benign 0.00
R5444:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5498:Spag17 UTSW 3 100,010,661 (GRCm39) missense possibly damaging 0.83
R5503:Spag17 UTSW 3 99,934,560 (GRCm39) missense possibly damaging 0.72
R5540:Spag17 UTSW 3 99,963,588 (GRCm39) missense possibly damaging 0.91
R5547:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5575:Spag17 UTSW 3 99,961,138 (GRCm39) missense possibly damaging 0.85
R5629:Spag17 UTSW 3 99,987,435 (GRCm39) missense probably benign 0.33
R5639:Spag17 UTSW 3 99,963,482 (GRCm39) missense probably damaging 1.00
R5842:Spag17 UTSW 3 99,846,566 (GRCm39) missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100,003,107 (GRCm39) nonsense probably null
R6082:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R6228:Spag17 UTSW 3 99,929,918 (GRCm39) missense probably benign 0.33
R6254:Spag17 UTSW 3 99,972,901 (GRCm39) missense probably benign 0.03
R6321:Spag17 UTSW 3 99,995,743 (GRCm39) missense probably benign 0.05
R6446:Spag17 UTSW 3 100,010,448 (GRCm39) missense probably benign
R6687:Spag17 UTSW 3 100,000,266 (GRCm39) missense probably benign 0.07
R6853:Spag17 UTSW 3 99,920,551 (GRCm39) missense possibly damaging 0.86
R6946:Spag17 UTSW 3 99,911,999 (GRCm39) missense possibly damaging 0.53
R6953:Spag17 UTSW 3 99,942,291 (GRCm39) missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99,891,925 (GRCm39) missense probably benign 0.00
R7084:Spag17 UTSW 3 99,846,586 (GRCm39) missense probably benign 0.18
R7126:Spag17 UTSW 3 100,008,751 (GRCm39) missense probably benign 0.00
R7144:Spag17 UTSW 3 99,934,717 (GRCm39) splice site probably null
R7198:Spag17 UTSW 3 100,002,888 (GRCm39) missense probably benign 0.02
R7318:Spag17 UTSW 3 99,847,299 (GRCm39) missense probably benign 0.00
R7403:Spag17 UTSW 3 99,846,691 (GRCm39) missense possibly damaging 0.53
R7409:Spag17 UTSW 3 99,941,475 (GRCm39) missense probably benign 0.00
R7409:Spag17 UTSW 3 99,934,547 (GRCm39) missense possibly damaging 0.73
R7537:Spag17 UTSW 3 99,846,563 (GRCm39) missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100,002,911 (GRCm39) nonsense probably null
R7772:Spag17 UTSW 3 99,987,434 (GRCm39) missense probably damaging 0.98
R7842:Spag17 UTSW 3 99,961,174 (GRCm39) missense probably benign 0.18
R7963:Spag17 UTSW 3 99,929,954 (GRCm39) missense probably benign 0.02
R8168:Spag17 UTSW 3 99,942,300 (GRCm39) missense possibly damaging 0.96
R8291:Spag17 UTSW 3 99,968,166 (GRCm39) missense probably benign
R8347:Spag17 UTSW 3 99,934,957 (GRCm39) missense probably benign
R8383:Spag17 UTSW 3 99,992,708 (GRCm39) missense probably damaging 0.98
R8474:Spag17 UTSW 3 99,934,586 (GRCm39) missense probably benign 0.00
R8804:Spag17 UTSW 3 99,874,506 (GRCm39) missense probably benign
R8809:Spag17 UTSW 3 99,889,738 (GRCm39) missense probably benign 0.33
R8818:Spag17 UTSW 3 99,920,543 (GRCm39) missense probably benign 0.02
R8830:Spag17 UTSW 3 100,032,751 (GRCm39) missense possibly damaging 0.77
R8890:Spag17 UTSW 3 99,911,994 (GRCm39) missense possibly damaging 0.73
R9008:Spag17 UTSW 3 99,934,942 (GRCm39) missense possibly damaging 0.73
R9095:Spag17 UTSW 3 99,912,092 (GRCm39) missense possibly damaging 0.86
R9143:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R9182:Spag17 UTSW 3 99,966,158 (GRCm39) missense possibly damaging 0.92
R9211:Spag17 UTSW 3 100,032,614 (GRCm39) critical splice acceptor site probably benign
R9344:Spag17 UTSW 3 100,010,793 (GRCm39) missense probably benign 0.01
R9354:Spag17 UTSW 3 99,934,905 (GRCm39) missense probably benign
R9527:Spag17 UTSW 3 99,970,777 (GRCm39) missense probably damaging 1.00
R9658:Spag17 UTSW 3 99,934,932 (GRCm39) missense possibly damaging 0.93
R9738:Spag17 UTSW 3 99,934,526 (GRCm39) missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100,008,767 (GRCm39) missense probably benign 0.31
Z1088:Spag17 UTSW 3 100,002,946 (GRCm39) missense probably benign 0.09
Z1176:Spag17 UTSW 3 99,920,309 (GRCm39) missense probably benign 0.18
Z1177:Spag17 UTSW 3 99,995,715 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAACTTTGCCGCCAGTC -3'
(R):5'- TCTTGGCTTAGGGGATAACTAATG -3'

Sequencing Primer
(F):5'- ATTCCAATGGGTCTGAGGCAC -3'
(R):5'- GGGGATAACTAATGAAGACCATTTTG -3'
Posted On 2021-01-18