Incidental Mutation 'R8529:Slc44a3'
ID 658928
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Name solute carrier family 44, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8529 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 121459528-121532404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121525685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 136 (L136I)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
AlphaFold Q921V7
Predicted Effect probably benign
Transcript: ENSMUST00000039197
AA Change: L136I

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: L136I

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,032,435 Y155F probably benign Het
Acbd5 A G 2: 23,080,692 Y173C probably benign Het
Ankrd55 A T 13: 112,344,136 T192S probably benign Het
Apob A T 12: 8,007,353 H1912L probably damaging Het
BC051142 G T 17: 34,460,169 C302F possibly damaging Het
Bcl2l11 T C 2: 128,128,876 S82P possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Btnl10 A T 11: 58,922,412 D289V probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Crybg3 C A 16: 59,556,621 K1423N probably damaging Het
Dgat1 T A 15: 76,503,037 Y350F probably damaging Het
Dhx36 TCCGCCGCCGCCGCCGC TCCGCCGCCGCCGC 3: 62,506,856 probably benign Het
Edc4 A G 8: 105,885,050 D86G probably damaging Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Erbb3 A G 10: 128,583,200 V264A probably damaging Het
Fam149b T A 14: 20,358,302 probably null Het
Foxc1 A G 13: 31,808,537 S444G unknown Het
Gm2042 G A 12: 87,960,086 S391N possibly damaging Het
Gm21119 A G 8: 20,619,158 D176G possibly damaging Het
Gm38394 T C 1: 133,656,968 Y877C probably benign Het
Gnb3 A T 6: 124,837,670 N88K probably benign Het
Ifnar2 T A 16: 91,391,796 V157D possibly damaging Het
Il27 A T 7: 126,592,805 L53Q probably damaging Het
Ints13 T C 6: 146,563,428 E225G probably damaging Het
Itpr2 G A 6: 146,329,553 R1167C probably damaging Het
Lrp2 A T 2: 69,500,642 I1690K probably damaging Het
Lrrc37a T C 11: 103,457,547 E2774G unknown Het
Lyz2 A T 10: 117,280,663 N93K probably damaging Het
Mki67 A G 7: 135,713,959 probably null Het
Mroh1 T C 15: 76,427,632 F522L probably benign Het
Myo5a A G 9: 75,212,872 I1626V probably benign Het
Nav3 A T 10: 109,853,331 S362T probably benign Het
Neurl4 C T 11: 69,908,787 P972L probably damaging Het
Olfr1340 A T 4: 118,726,573 T109S probably benign Het
Olfr151 A T 9: 37,730,956 V9E probably damaging Het
Olfr266 A T 3: 106,821,793 Y255* probably null Het
Prdm5 C T 6: 65,901,845 R128C probably damaging Het
Prom1 A T 5: 44,013,027 probably null Het
Prrc2c T A 1: 162,709,094 probably benign Het
Ptprd T C 4: 76,129,025 T322A probably damaging Het
Reg3d C G 6: 78,376,399 G154R probably null Het
Rsf1 A G 7: 97,670,867 probably benign Het
Ryr1 T A 7: 29,070,084 T2724S possibly damaging Het
Sec63 A G 10: 42,789,383 Y103C probably damaging Het
Serpinb9b A T 13: 33,039,560 D245V probably benign Het
Slc22a28 G A 19: 8,063,413 T491I probably benign Het
Slc24a2 T C 4: 87,028,280 N484S possibly damaging Het
Tff3 A G 17: 31,129,486 probably null Het
Tpp2 T A 1: 43,983,140 D899E probably benign Het
Tsen54 G T 11: 115,820,560 D268Y possibly damaging Het
Ttbk2 A C 2: 120,773,857 V220G possibly damaging Het
Uggt1 A G 1: 36,184,432 V592A possibly damaging Het
Usp49 A T 17: 47,672,112 Q14L probably damaging Het
Vldlr T A 19: 27,230,256 L48Q probably benign Het
Zp3 C A 5: 135,987,265 T282N probably damaging Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R8856:Slc44a3 UTSW 3 121513807 missense probably damaging 1.00
R9053:Slc44a3 UTSW 3 121527190 missense probably damaging 1.00
R9121:Slc44a3 UTSW 3 121461137 missense probably benign 0.00
R9360:Slc44a3 UTSW 3 121532259 start gained probably benign
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCAGGGCTTCAGATAAGTC -3'
(R):5'- TTACACCAATGAGAATCGGTGC -3'

Sequencing Primer
(F):5'- AGTTCATGAGAAAACCCTCCTGTTC -3'
(R):5'- TGAGAATCGGTGCCCTGAG -3'
Posted On 2021-01-18