Incidental Mutation 'R8529:Erbb3'
ID658953
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8529 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128583200 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 264 (V264A)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
Predicted Effect probably damaging
Transcript: ENSMUST00000082059
AA Change: V264A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: V264A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,032,435 Y155F probably benign Het
Acbd5 A G 2: 23,080,692 Y173C probably benign Het
Ankrd55 A T 13: 112,344,136 T192S probably benign Het
Apob A T 12: 8,007,353 H1912L probably damaging Het
BC051142 G T 17: 34,460,169 C302F possibly damaging Het
Bcl2l11 T C 2: 128,128,876 S82P possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Btnl10 A T 11: 58,922,412 D289V probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Crybg3 C A 16: 59,556,621 K1423N probably damaging Het
Dgat1 T A 15: 76,503,037 Y350F probably damaging Het
Dhx36 TCCGCCGCCGCCGCCGC TCCGCCGCCGCCGC 3: 62,506,856 probably benign Het
Edc4 A G 8: 105,885,050 D86G probably damaging Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam149b T A 14: 20,358,302 probably null Het
Foxc1 A G 13: 31,808,537 S444G unknown Het
Gm2042 G A 12: 87,960,086 S391N possibly damaging Het
Gm21119 A G 8: 20,619,158 D176G possibly damaging Het
Gm38394 T C 1: 133,656,968 Y877C probably benign Het
Gnb3 A T 6: 124,837,670 N88K probably benign Het
Ifnar2 T A 16: 91,391,796 V157D possibly damaging Het
Il27 A T 7: 126,592,805 L53Q probably damaging Het
Ints13 T C 6: 146,563,428 E225G probably damaging Het
Itpr2 G A 6: 146,329,553 R1167C probably damaging Het
Lrp2 A T 2: 69,500,642 I1690K probably damaging Het
Lrrc37a T C 11: 103,457,547 E2774G unknown Het
Lyz2 A T 10: 117,280,663 N93K probably damaging Het
Mki67 A G 7: 135,713,959 probably null Het
Mroh1 T C 15: 76,427,632 F522L probably benign Het
Myo5a A G 9: 75,212,872 I1626V probably benign Het
Nav3 A T 10: 109,853,331 S362T probably benign Het
Neurl4 C T 11: 69,908,787 P972L probably damaging Het
Olfr1340 A T 4: 118,726,573 T109S probably benign Het
Olfr151 A T 9: 37,730,956 V9E probably damaging Het
Olfr266 A T 3: 106,821,793 Y255* probably null Het
Prdm5 C T 6: 65,901,845 R128C probably damaging Het
Prom1 A T 5: 44,013,027 probably null Het
Prrc2c T A 1: 162,709,094 probably benign Het
Ptprd T C 4: 76,129,025 T322A probably damaging Het
Reg3d C G 6: 78,376,399 G154R probably null Het
Rsf1 A G 7: 97,670,867 probably benign Het
Ryr1 T A 7: 29,070,084 T2724S possibly damaging Het
Sec63 A G 10: 42,789,383 Y103C probably damaging Het
Serpinb9b A T 13: 33,039,560 D245V probably benign Het
Slc22a28 G A 19: 8,063,413 T491I probably benign Het
Slc24a2 T C 4: 87,028,280 N484S possibly damaging Het
Slc44a3 G T 3: 121,525,685 L136I probably benign Het
Tff3 A G 17: 31,129,486 probably null Het
Tpp2 T A 1: 43,983,140 D899E probably benign Het
Tsen54 G T 11: 115,820,560 D268Y possibly damaging Het
Ttbk2 A C 2: 120,773,857 V220G possibly damaging Het
Uggt1 A G 1: 36,184,432 V592A possibly damaging Het
Usp49 A T 17: 47,672,112 Q14L probably damaging Het
Vldlr T A 19: 27,230,256 L48Q probably benign Het
Zp3 C A 5: 135,987,265 T282N probably damaging Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R8843:Erbb3 UTSW 10 128578456 missense possibly damaging 0.82
R8988:Erbb3 UTSW 10 128570161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGATGTCACTCACTAGGTG -3'
(R):5'- CCAGGACACAGATTGCTTCG -3'

Sequencing Primer
(F):5'- GGTCACATAATCACATCTAGGTTCC -3'
(R):5'- CGTATGTAATGGTGCCATCAGCC -3'
Posted On2021-01-18