Incidental Mutation 'R8529:Ifnar2'
ID 658967
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Name interferon (alpha and beta) receptor 2
Synonyms Ifnar-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R8529 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 91372783-91405589 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91391796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 157 (V157D)
Ref Sequence ENSEMBL: ENSMUSP00000113358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000117836] [ENSMUST00000134491] [ENSMUST00000139503]
AlphaFold O35664
Predicted Effect possibly damaging
Transcript: ENSMUST00000023693
AA Change: V157D

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971
AA Change: V157D

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089042
AA Change: V157D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971
AA Change: V157D

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117836
AA Change: V157D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113358
Gene: ENSMUSG00000022971
AA Change: V157D

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134491
AA Change: V55D

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134796
Gene: ENSMUSG00000022971
AA Change: V55D

DomainStartEndE-ValueType
Pfam:Interfer-bind 30 117 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139503
Predicted Effect
SMART Domains Protein: ENSMUSP00000123997
Gene: ENSMUSG00000093701
AA Change: V25D

DomainStartEndE-ValueType
FN3 2 92 5.1e1 SMART
FN3 110 187 9.09e0 SMART
FN3 201 291 1.39e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125579
Gene: ENSMUSG00000093701
AA Change: V25D

DomainStartEndE-ValueType
Pfam:Interfer-bind 1 100 7.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,032,435 Y155F probably benign Het
Acbd5 A G 2: 23,080,692 Y173C probably benign Het
Ankrd55 A T 13: 112,344,136 T192S probably benign Het
Apob A T 12: 8,007,353 H1912L probably damaging Het
BC051142 G T 17: 34,460,169 C302F possibly damaging Het
Bcl2l11 T C 2: 128,128,876 S82P possibly damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Btnl10 A T 11: 58,922,412 D289V probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Crybg3 C A 16: 59,556,621 K1423N probably damaging Het
Dgat1 T A 15: 76,503,037 Y350F probably damaging Het
Dhx36 TCCGCCGCCGCCGCCGC TCCGCCGCCGCCGC 3: 62,506,856 probably benign Het
Edc4 A G 8: 105,885,050 D86G probably damaging Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Erbb3 A G 10: 128,583,200 V264A probably damaging Het
Fam149b T A 14: 20,358,302 probably null Het
Foxc1 A G 13: 31,808,537 S444G unknown Het
Gm2042 G A 12: 87,960,086 S391N possibly damaging Het
Gm21119 A G 8: 20,619,158 D176G possibly damaging Het
Gm38394 T C 1: 133,656,968 Y877C probably benign Het
Gnb3 A T 6: 124,837,670 N88K probably benign Het
Il27 A T 7: 126,592,805 L53Q probably damaging Het
Ints13 T C 6: 146,563,428 E225G probably damaging Het
Itpr2 G A 6: 146,329,553 R1167C probably damaging Het
Lrp2 A T 2: 69,500,642 I1690K probably damaging Het
Lrrc37a T C 11: 103,457,547 E2774G unknown Het
Lyz2 A T 10: 117,280,663 N93K probably damaging Het
Mki67 A G 7: 135,713,959 probably null Het
Mroh1 T C 15: 76,427,632 F522L probably benign Het
Myo5a A G 9: 75,212,872 I1626V probably benign Het
Nav3 A T 10: 109,853,331 S362T probably benign Het
Neurl4 C T 11: 69,908,787 P972L probably damaging Het
Olfr1340 A T 4: 118,726,573 T109S probably benign Het
Olfr151 A T 9: 37,730,956 V9E probably damaging Het
Olfr266 A T 3: 106,821,793 Y255* probably null Het
Prdm5 C T 6: 65,901,845 R128C probably damaging Het
Prom1 A T 5: 44,013,027 probably null Het
Prrc2c T A 1: 162,709,094 probably benign Het
Ptprd T C 4: 76,129,025 T322A probably damaging Het
Reg3d C G 6: 78,376,399 G154R probably null Het
Rsf1 A G 7: 97,670,867 probably benign Het
Ryr1 T A 7: 29,070,084 T2724S possibly damaging Het
Sec63 A G 10: 42,789,383 Y103C probably damaging Het
Serpinb9b A T 13: 33,039,560 D245V probably benign Het
Slc22a28 G A 19: 8,063,413 T491I probably benign Het
Slc24a2 T C 4: 87,028,280 N484S possibly damaging Het
Slc44a3 G T 3: 121,525,685 L136I probably benign Het
Tff3 A G 17: 31,129,486 probably null Het
Tpp2 T A 1: 43,983,140 D899E probably benign Het
Tsen54 G T 11: 115,820,560 D268Y possibly damaging Het
Ttbk2 A C 2: 120,773,857 V220G possibly damaging Het
Uggt1 A G 1: 36,184,432 V592A possibly damaging Het
Usp49 A T 17: 47,672,112 Q14L probably damaging Het
Vldlr T A 19: 27,230,256 L48Q probably benign Het
Zp3 C A 5: 135,987,265 T282N probably damaging Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91391711 unclassified probably benign
IGL02817:Ifnar2 APN 16 91387992 missense probably benign 0.01
macro-2 UTSW 16 91383899 start codon destroyed probably null
R0701:Ifnar2 UTSW 16 91404229 missense possibly damaging 0.53
R1342:Ifnar2 UTSW 16 91403921 missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91399265 missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91391867 missense probably benign 0.00
R1913:Ifnar2 UTSW 16 91404170 missense probably benign 0.33
R3078:Ifnar2 UTSW 16 91386001 missense possibly damaging 0.86
R4193:Ifnar2 UTSW 16 91404344 missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91391796 missense probably benign
R5385:Ifnar2 UTSW 16 91404198 missense possibly damaging 0.70
R5545:Ifnar2 UTSW 16 91385025 critical splice donor site probably null
R5645:Ifnar2 UTSW 16 91404227 missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91387988 missense probably damaging 0.98
R6371:Ifnar2 UTSW 16 91388098 missense possibly damaging 0.95
R6710:Ifnar2 UTSW 16 91393883 missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91393878 nonsense probably null
R7530:Ifnar2 UTSW 16 91404313 missense probably benign 0.18
R7763:Ifnar2 UTSW 16 91399293 missense probably benign 0.02
R8444:Ifnar2 UTSW 16 91403969 missense possibly damaging 0.93
R8969:Ifnar2 UTSW 16 91404172 missense probably benign 0.18
R9016:Ifnar2 UTSW 16 91404185 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCCATTCAGACAGAATTAGC -3'
(R):5'- CGTCTAAAGTAACCCTTCCCTGG -3'

Sequencing Primer
(F):5'- GCCCATTCAGACAGAATTAGCCTTTC -3'
(R):5'- CTGGCCTTACACAGTTCTTGAGAAG -3'
Posted On 2021-01-18