Incidental Mutation 'R8530:Bcas1'
ID658978
Institutional Source Beutler Lab
Gene Symbol Bcas1
Ensembl Gene ENSMUSG00000013523
Gene Namebreast carcinoma amplified sequence 1
Synonyms9030223A09Rik, 2210416M21Rik, NABC1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8530 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location170346991-170427845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 170387948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 244 (I244K)
Ref Sequence ENSEMBL: ENSMUSP00000013667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013667] [ENSMUST00000068137] [ENSMUST00000109152]
Predicted Effect probably damaging
Transcript: ENSMUST00000013667
AA Change: I244K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000013667
Gene: ENSMUSG00000013523
AA Change: I244K

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 391 398 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068137
AA Change: I234K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069437
Gene: ENSMUSG00000013523
AA Change: I234K

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 335 342 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109152
AA Change: I244K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104780
Gene: ENSMUSG00000013523
AA Change: I244K

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 312 N/A INTRINSIC
low complexity region 345 352 N/A INTRINSIC
low complexity region 496 508 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122298
Gene: ENSMUSG00000013523
AA Change: I80K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G C 3: 138,068,825 E1258D probably damaging Het
4930407I10Rik T A 15: 82,065,386 H1161Q probably damaging Het
Adam20 A G 8: 40,796,034 S394G probably damaging Het
Akr1c12 A T 13: 4,270,161 F310Y probably benign Het
Ank G A 15: 27,544,404 A84T probably benign Het
BC027072 T C 17: 71,752,106 Y192C probably damaging Het
Cacna1a T C 8: 84,612,414 probably null Het
Car14 T C 3: 95,900,358 H79R probably benign Het
Cd163 T C 6: 124,318,901 Y735H probably damaging Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Cfi C T 3: 129,850,733 T126I possibly damaging Het
Col6a4 T A 9: 106,080,505 H40L probably benign Het
Dbh A G 2: 27,168,306 D162G probably damaging Het
Dnah14 A G 1: 181,664,946 K1657R probably damaging Het
E2f7 T A 10: 110,778,998 V521D probably benign Het
Eif3g A C 9: 20,897,730 S93A possibly damaging Het
Fa2h T C 8: 111,356,156 E143G probably benign Het
Foxc1 C A 13: 31,807,788 P194Q probably benign Het
Fyco1 A G 9: 123,840,540 probably null Het
Gabrb3 T C 7: 57,812,071 S256P probably damaging Het
Gcc1 C A 6: 28,420,731 D196Y probably damaging Het
Gm15319 T C 8: 20,356,984 N242S probably benign Het
Herc1 T A 9: 66,418,628 D1461E probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hps6 A T 19: 46,003,520 probably benign Het
Macc1 A T 12: 119,445,739 I81F probably damaging Het
Man2c1 G T 9: 57,131,638 D111Y probably damaging Het
Mast3 A T 8: 70,788,233 I240N possibly damaging Het
Matn1 A T 4: 130,950,136 K219* probably null Het
Nup210 C G 6: 91,076,645 A297P possibly damaging Het
Olfr1173 A T 2: 88,274,810 L80I probably damaging Het
Olfr212 T A 6: 116,516,569 I264K probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Phactr3 A G 2: 178,284,026 N360D probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Qtrt2 C A 16: 43,869,044 G197V probably damaging Het
Rabep1 A T 11: 70,919,242 L500F probably damaging Het
Rhof T A 5: 123,119,518 D183V probably damaging Het
Shprh T C 10: 11,151,934 V95A probably benign Het
Spata31d1b A T 13: 59,717,150 N704I unknown Het
Tas1r2 A T 4: 139,662,149 Y452F probably benign Het
Tc2n A T 12: 101,651,185 F325Y possibly damaging Het
Tiam2 G T 17: 3,450,812 V909L probably benign Het
Tlx1 A T 19: 45,151,085 Y57F probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn2r58 A T 7: 41,864,152 W356R probably damaging Het
Wars G A 12: 108,882,892 A43V probably damaging Het
Wrn A T 8: 33,280,824 I694N possibly damaging Het
Zfp120 A G 2: 150,117,248 Y385H probably benign Het
Other mutations in Bcas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Bcas1 APN 2 170349252 missense probably damaging 0.99
IGL01714:Bcas1 APN 2 170384182 splice site probably benign
IGL02267:Bcas1 APN 2 170378788 nonsense probably null
IGL02486:Bcas1 APN 2 170406398 missense probably damaging 1.00
IGL03328:Bcas1 APN 2 170366396 nonsense probably null
R0335:Bcas1 UTSW 2 170418681 missense probably damaging 0.97
R1458:Bcas1 UTSW 2 170387951 missense probably damaging 1.00
R1463:Bcas1 UTSW 2 170418664 missense probably benign 0.07
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1507:Bcas1 UTSW 2 170366428 missense probably damaging 0.99
R1645:Bcas1 UTSW 2 170387167 missense probably damaging 1.00
R1654:Bcas1 UTSW 2 170349246 missense probably damaging 1.00
R1911:Bcas1 UTSW 2 170387943 missense probably damaging 1.00
R1990:Bcas1 UTSW 2 170370477 missense possibly damaging 0.83
R2017:Bcas1 UTSW 2 170348161 splice site probably null
R4119:Bcas1 UTSW 2 170378815 missense probably benign 0.02
R4181:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4302:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4497:Bcas1 UTSW 2 170406821 missense probably damaging 1.00
R4670:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4671:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4914:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4915:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4917:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4918:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R5155:Bcas1 UTSW 2 170418618 missense probably damaging 0.98
R5354:Bcas1 UTSW 2 170349396 missense possibly damaging 0.94
R5686:Bcas1 UTSW 2 170406810 missense probably benign 0.03
R7566:Bcas1 UTSW 2 170370449 critical splice donor site probably null
R7736:Bcas1 UTSW 2 170387164 missense possibly damaging 0.89
R7816:Bcas1 UTSW 2 170406427 missense probably benign 0.11
R7850:Bcas1 UTSW 2 170348103 missense probably damaging 1.00
R8078:Bcas1 UTSW 2 170418612 missense possibly damaging 0.87
R8350:Bcas1 UTSW 2 170406300 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AACAGTGACCACTACTTACCAGTG -3'
(R):5'- CTCTGGCCCCAAACAATGTC -3'

Sequencing Primer
(F):5'- CCAGTGTCTTGAAGAAGCTCATG -3'
(R):5'- TCCTACCATCTGTGATGAATGTG -3'
Posted On2021-01-18