Incidental Mutation 'R8530:Cfi'
ID658981
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8530 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129850733 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 126 (T126I)
Ref Sequence ENSEMBL: ENSMUSP00000142975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077918
AA Change: T126I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: T126I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200206
AA Change: T126I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952
AA Change: T126I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G C 3: 138,068,825 E1258D probably damaging Het
4930407I10Rik T A 15: 82,065,386 H1161Q probably damaging Het
Adam20 A G 8: 40,796,034 S394G probably damaging Het
Akr1c12 A T 13: 4,270,161 F310Y probably benign Het
Ank G A 15: 27,544,404 A84T probably benign Het
BC027072 T C 17: 71,752,106 Y192C probably damaging Het
Bcas1 A T 2: 170,387,948 I244K probably damaging Het
Cacna1a T C 8: 84,612,414 probably null Het
Car14 T C 3: 95,900,358 H79R probably benign Het
Cd163 T C 6: 124,318,901 Y735H probably damaging Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Col6a4 T A 9: 106,080,505 H40L probably benign Het
Dbh A G 2: 27,168,306 D162G probably damaging Het
Dnah14 A G 1: 181,664,946 K1657R probably damaging Het
E2f7 T A 10: 110,778,998 V521D probably benign Het
Eif3g A C 9: 20,897,730 S93A possibly damaging Het
Fa2h T C 8: 111,356,156 E143G probably benign Het
Foxc1 C A 13: 31,807,788 P194Q probably benign Het
Fyco1 A G 9: 123,840,540 probably null Het
Gabrb3 T C 7: 57,812,071 S256P probably damaging Het
Gcc1 C A 6: 28,420,731 D196Y probably damaging Het
Gm15319 T C 8: 20,356,984 N242S probably benign Het
Herc1 T A 9: 66,418,628 D1461E probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hps6 A T 19: 46,003,520 probably benign Het
Macc1 A T 12: 119,445,739 I81F probably damaging Het
Man2c1 G T 9: 57,131,638 D111Y probably damaging Het
Mast3 A T 8: 70,788,233 I240N possibly damaging Het
Matn1 A T 4: 130,950,136 K219* probably null Het
Nup210 C G 6: 91,076,645 A297P possibly damaging Het
Olfr1173 A T 2: 88,274,810 L80I probably damaging Het
Olfr212 T A 6: 116,516,569 I264K probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Phactr3 A G 2: 178,284,026 N360D probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Qtrt2 C A 16: 43,869,044 G197V probably damaging Het
Rabep1 A T 11: 70,919,242 L500F probably damaging Het
Rhof T A 5: 123,119,518 D183V probably damaging Het
Shprh T C 10: 11,151,934 V95A probably benign Het
Spata31d1b A T 13: 59,717,150 N704I unknown Het
Tas1r2 A T 4: 139,662,149 Y452F probably benign Het
Tc2n A T 12: 101,651,185 F325Y possibly damaging Het
Tiam2 G T 17: 3,450,812 V909L probably benign Het
Tlx1 A T 19: 45,151,085 Y57F probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn2r58 A T 7: 41,864,152 W356R probably damaging Het
Wars G A 12: 108,882,892 A43V probably damaging Het
Wrn A T 8: 33,280,824 I694N possibly damaging Het
Zfp120 A G 2: 150,117,248 Y385H probably benign Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7194:Cfi UTSW 3 129855059 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7908:Cfi UTSW 3 129848584 missense probably benign 0.01
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8017:Cfi UTSW 3 129855099 missense probably benign 0.00
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8155:Cfi UTSW 3 129855090 missense probably benign 0.00
R8217:Cfi UTSW 3 129855001 missense possibly damaging 0.61
R8767:Cfi UTSW 3 129850848 critical splice donor site probably null
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGATCGATGTGAGAATTAGCTCTC -3'
(R):5'- TTGCATAGAAGGCACTACACAG -3'

Sequencing Primer
(F):5'- CATCATGACATTCAAAGTTAAC -3'
(R):5'- CTACACAGTAGAGAGATTAAGCAGTC -3'
Posted On2021-01-18