Mutagenetix > Incidental Mutation

Incidental Mutation 'R8530:Mast3'

658995

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

068500-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8530 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70788233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 240 (I240N)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: I240N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I240N

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211948
AA Change: I224N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	C	3: 138,068,825	E1258D	probably damaging	Het
4930407I10Rik	T	A	15: 82,065,386	H1161Q	probably damaging	Het
Adam20	A	G	8: 40,796,034	S394G	probably damaging	Het
Akr1c12	A	T	13: 4,270,161	F310Y	probably benign	Het
Ank	G	A	15: 27,544,404	A84T	probably benign	Het
BC027072	T	C	17: 71,752,106	Y192C	probably damaging	Het
Bcas1	A	T	2: 170,387,948	I244K	probably damaging	Het
Cacna1a	T	C	8: 84,612,414		probably null	Het
Car14	T	C	3: 95,900,358	H79R	probably benign	Het
Cd163	T	C	6: 124,318,901	Y735H	probably damaging	Het
Cdh11	G	A	8: 102,664,755	P283L	probably benign	Het
Cfi	C	T	3: 129,850,733	T126I	possibly damaging	Het
Col6a4	T	A	9: 106,080,505	H40L	probably benign	Het
Dbh	A	G	2: 27,168,306	D162G	probably damaging	Het
Dnah14	A	G	1: 181,664,946	K1657R	probably damaging	Het
E2f7	T	A	10: 110,778,998	V521D	probably benign	Het
Eif3g	A	C	9: 20,897,730	S93A	possibly damaging	Het
Fa2h	T	C	8: 111,356,156	E143G	probably benign	Het
Foxc1	C	A	13: 31,807,788	P194Q	probably benign	Het
Fyco1	A	G	9: 123,840,540		probably null	Het
Gabrb3	T	C	7: 57,812,071	S256P	probably damaging	Het
Gcc1	C	A	6: 28,420,731	D196Y	probably damaging	Het
Gm15319	T	C	8: 20,356,984	N242S	probably benign	Het
Herc1	T	A	9: 66,418,628	D1461E	probably benign	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hps6	A	T	19: 46,003,520		probably benign	Het
Macc1	A	T	12: 119,445,739	I81F	probably damaging	Het
Man2c1	G	T	9: 57,131,638	D111Y	probably damaging	Het
Matn1	A	T	4: 130,950,136	K219*	probably null	Het
Nup210	C	G	6: 91,076,645	A297P	possibly damaging	Het
Olfr1173	A	T	2: 88,274,810	L80I	probably damaging	Het
Olfr212	T	A	6: 116,516,569	I264K	probably damaging	Het
Pcnt	G	A	10: 76,420,205	R734W	probably damaging	Het
Phactr3	A	G	2: 178,284,026	N360D	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Qtrt2	C	A	16: 43,869,044	G197V	probably damaging	Het
Rabep1	A	T	11: 70,919,242	L500F	probably damaging	Het
Rhof	T	A	5: 123,119,518	D183V	probably damaging	Het
Shprh	T	C	10: 11,151,934	V95A	probably benign	Het
Spata31d1b	A	T	13: 59,717,150	N704I	unknown	Het
Tas1r2	A	T	4: 139,662,149	Y452F	probably benign	Het
Tc2n	A	T	12: 101,651,185	F325Y	possibly damaging	Het
Tiam2	G	T	17: 3,450,812	V909L	probably benign	Het
Tlx1	A	T	19: 45,151,085	Y57F	probably benign	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Vmn2r58	A	T	7: 41,864,152	W356R	probably damaging	Het
Wars	G	A	12: 108,882,892	A43V	probably damaging	Het
Wrn	A	T	8: 33,280,824	I694N	possibly damaging	Het
Zfp120	A	G	2: 150,117,248	Y385H	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTATAGGGGACAGCCATG -3'
(R):5'- TGTCCTGTCTGACGATAGCC -3'

Sequencing Primer
(F):5'- ATGGCTCCGCAGACTCCAC -3'
(R):5'- AGACTTCTGGACTGTCCTCTG -3'

Posted On

2021-01-18