Incidental Mutation 'R8530:Fyco1'
ID659004
Institutional Source Beutler Lab
Gene Symbol Fyco1
Ensembl Gene ENSMUSG00000025241
Gene NameFYVE and coiled-coil domain containing 1
SynonymsMem2, ZFYVE7, 2810409M01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8530 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123789500-123851899 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 123840540 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000184082]
Predicted Effect probably null
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000184082
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G C 3: 138,068,825 E1258D probably damaging Het
4930407I10Rik T A 15: 82,065,386 H1161Q probably damaging Het
Adam20 A G 8: 40,796,034 S394G probably damaging Het
Akr1c12 A T 13: 4,270,161 F310Y probably benign Het
Ank G A 15: 27,544,404 A84T probably benign Het
BC027072 T C 17: 71,752,106 Y192C probably damaging Het
Bcas1 A T 2: 170,387,948 I244K probably damaging Het
Cacna1a T C 8: 84,612,414 probably null Het
Car14 T C 3: 95,900,358 H79R probably benign Het
Cd163 T C 6: 124,318,901 Y735H probably damaging Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Cfi C T 3: 129,850,733 T126I possibly damaging Het
Col6a4 T A 9: 106,080,505 H40L probably benign Het
Dbh A G 2: 27,168,306 D162G probably damaging Het
Dnah14 A G 1: 181,664,946 K1657R probably damaging Het
E2f7 T A 10: 110,778,998 V521D probably benign Het
Eif3g A C 9: 20,897,730 S93A possibly damaging Het
Fa2h T C 8: 111,356,156 E143G probably benign Het
Foxc1 C A 13: 31,807,788 P194Q probably benign Het
Gabrb3 T C 7: 57,812,071 S256P probably damaging Het
Gcc1 C A 6: 28,420,731 D196Y probably damaging Het
Gm15319 T C 8: 20,356,984 N242S probably benign Het
Herc1 T A 9: 66,418,628 D1461E probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hps6 A T 19: 46,003,520 probably benign Het
Macc1 A T 12: 119,445,739 I81F probably damaging Het
Man2c1 G T 9: 57,131,638 D111Y probably damaging Het
Mast3 A T 8: 70,788,233 I240N possibly damaging Het
Matn1 A T 4: 130,950,136 K219* probably null Het
Nup210 C G 6: 91,076,645 A297P possibly damaging Het
Olfr1173 A T 2: 88,274,810 L80I probably damaging Het
Olfr212 T A 6: 116,516,569 I264K probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Phactr3 A G 2: 178,284,026 N360D probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Qtrt2 C A 16: 43,869,044 G197V probably damaging Het
Rabep1 A T 11: 70,919,242 L500F probably damaging Het
Rhof T A 5: 123,119,518 D183V probably damaging Het
Shprh T C 10: 11,151,934 V95A probably benign Het
Spata31d1b A T 13: 59,717,150 N704I unknown Het
Tas1r2 A T 4: 139,662,149 Y452F probably benign Het
Tc2n A T 12: 101,651,185 F325Y possibly damaging Het
Tiam2 G T 17: 3,450,812 V909L probably benign Het
Tlx1 A T 19: 45,151,085 Y57F probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn2r58 A T 7: 41,864,152 W356R probably damaging Het
Wars G A 12: 108,882,892 A43V probably damaging Het
Wrn A T 8: 33,280,824 I694N possibly damaging Het
Zfp120 A G 2: 150,117,248 Y385H probably benign Het
Other mutations in Fyco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Fyco1 APN 9 123838897 missense probably damaging 1.00
IGL01407:Fyco1 APN 9 123828879 missense probably damaging 1.00
IGL01621:Fyco1 APN 9 123827182 unclassified probably benign
IGL01908:Fyco1 APN 9 123829230 missense probably damaging 1.00
IGL02006:Fyco1 APN 9 123829831 nonsense probably null
IGL02899:Fyco1 APN 9 123830331 missense possibly damaging 0.47
IGL03166:Fyco1 APN 9 123828387 missense probably benign 0.00
IGL03272:Fyco1 APN 9 123829603 missense probably benign 0.00
BB009:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
BB019:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
PIT4480001:Fyco1 UTSW 9 123828650 nonsense probably null
R0013:Fyco1 UTSW 9 123822406 missense probably benign
R0025:Fyco1 UTSW 9 123829009 missense probably damaging 1.00
R0349:Fyco1 UTSW 9 123797662 missense probably damaging 0.98
R0751:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1184:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1563:Fyco1 UTSW 9 123827182 unclassified probably benign
R1618:Fyco1 UTSW 9 123829281 missense probably damaging 1.00
R1732:Fyco1 UTSW 9 123819092 missense probably benign 0.32
R1873:Fyco1 UTSW 9 123823238 missense probably benign
R1920:Fyco1 UTSW 9 123830413 missense probably damaging 1.00
R2108:Fyco1 UTSW 9 123797516 critical splice donor site probably null
R2849:Fyco1 UTSW 9 123834826 nonsense probably null
R2944:Fyco1 UTSW 9 123826648 missense probably benign 0.02
R4035:Fyco1 UTSW 9 123801283 missense probably benign 0.00
R4120:Fyco1 UTSW 9 123825626 missense probably benign 0.00
R4198:Fyco1 UTSW 9 123826634 missense probably benign
R4534:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4535:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4536:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R5408:Fyco1 UTSW 9 123829503 missense probably damaging 0.99
R5522:Fyco1 UTSW 9 123794771 nonsense probably null
R5755:Fyco1 UTSW 9 123828708 missense possibly damaging 0.71
R5781:Fyco1 UTSW 9 123794833 missense probably damaging 1.00
R5813:Fyco1 UTSW 9 123831348 missense probably damaging 1.00
R7090:Fyco1 UTSW 9 123797719 missense probably damaging 0.98
R7205:Fyco1 UTSW 9 123822426 missense probably benign 0.00
R7932:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
R8086:Fyco1 UTSW 9 123830406 missense probably damaging 1.00
R8103:Fyco1 UTSW 9 123829388 missense probably benign 0.17
R8504:Fyco1 UTSW 9 123830077 missense probably benign 0.08
R8822:Fyco1 UTSW 9 123819119 missense probably damaging 1.00
R8899:Fyco1 UTSW 9 123826581 missense probably benign 0.00
Z1177:Fyco1 UTSW 9 123828323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGATGGCTTAAGTCTCAGAAG -3'
(R):5'- GCGTGTCAATTCTAGGGCTG -3'

Sequencing Primer
(F):5'- GAATGTTTTCAGTTCCCAGAACACC -3'
(R):5'- GTGTCAATTCTAGGGCTGTTAAAATG -3'
Posted On2021-01-18