Incidental Mutation 'R8530:BC027072'
ID659019
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R8530 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71752106 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 192 (Y192C)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably damaging
Transcript: ENSMUST00000057405
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: Y192C

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G C 3: 138,068,825 E1258D probably damaging Het
4930407I10Rik T A 15: 82,065,386 H1161Q probably damaging Het
Adam20 A G 8: 40,796,034 S394G probably damaging Het
Akr1c12 A T 13: 4,270,161 F310Y probably benign Het
Ank G A 15: 27,544,404 A84T probably benign Het
Bcas1 A T 2: 170,387,948 I244K probably damaging Het
Cacna1a T C 8: 84,612,414 probably null Het
Car14 T C 3: 95,900,358 H79R probably benign Het
Cd163 T C 6: 124,318,901 Y735H probably damaging Het
Cdh11 G A 8: 102,664,755 P283L probably benign Het
Cfi C T 3: 129,850,733 T126I possibly damaging Het
Col6a4 T A 9: 106,080,505 H40L probably benign Het
Dbh A G 2: 27,168,306 D162G probably damaging Het
Dnah14 A G 1: 181,664,946 K1657R probably damaging Het
E2f7 T A 10: 110,778,998 V521D probably benign Het
Eif3g A C 9: 20,897,730 S93A possibly damaging Het
Fa2h T C 8: 111,356,156 E143G probably benign Het
Foxc1 C A 13: 31,807,788 P194Q probably benign Het
Fyco1 A G 9: 123,840,540 probably null Het
Gabrb3 T C 7: 57,812,071 S256P probably damaging Het
Gcc1 C A 6: 28,420,731 D196Y probably damaging Het
Gm15319 T C 8: 20,356,984 N242S probably benign Het
Herc1 T A 9: 66,418,628 D1461E probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hps6 A T 19: 46,003,520 probably benign Het
Macc1 A T 12: 119,445,739 I81F probably damaging Het
Man2c1 G T 9: 57,131,638 D111Y probably damaging Het
Mast3 A T 8: 70,788,233 I240N possibly damaging Het
Matn1 A T 4: 130,950,136 K219* probably null Het
Nup210 C G 6: 91,076,645 A297P possibly damaging Het
Olfr1173 A T 2: 88,274,810 L80I probably damaging Het
Olfr212 T A 6: 116,516,569 I264K probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Phactr3 A G 2: 178,284,026 N360D probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Qtrt2 C A 16: 43,869,044 G197V probably damaging Het
Rabep1 A T 11: 70,919,242 L500F probably damaging Het
Rhof T A 5: 123,119,518 D183V probably damaging Het
Shprh T C 10: 11,151,934 V95A probably benign Het
Spata31d1b A T 13: 59,717,150 N704I unknown Het
Tas1r2 A T 4: 139,662,149 Y452F probably benign Het
Tc2n A T 12: 101,651,185 F325Y possibly damaging Het
Tiam2 G T 17: 3,450,812 V909L probably benign Het
Tlx1 A T 19: 45,151,085 Y57F probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn2r58 A T 7: 41,864,152 W356R probably damaging Het
Wars G A 12: 108,882,892 A43V probably damaging Het
Wrn A T 8: 33,280,824 I694N possibly damaging Het
Zfp120 A G 2: 150,117,248 Y385H probably benign Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
R8671:BC027072 UTSW 17 71751377 missense probably benign 0.34
R8831:BC027072 UTSW 17 71752310 missense probably benign 0.01
R8854:BC027072 UTSW 17 71749331 missense probably benign
R8941:BC027072 UTSW 17 71752142 missense probably benign 0.06
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTACTGCAGCAGCTG -3'
(R):5'- ACACAGGAAGTAGATTTCTCTGG -3'

Sequencing Primer
(F):5'- GTGTTGTTCCCAGGGCTCAC -3'
(R):5'- CAGGAAGTAGATTTCTCTGGGAAAG -3'
Posted On2021-01-18