Incidental Mutation 'R8531:Arhgef19'
ID659038
Institutional Source Beutler Lab
Gene Symbol Arhgef19
Ensembl Gene ENSMUSG00000028919
Gene NameRho guanine nucleotide exchange factor (GEF) 19
Synonyms6430573B13Rik, WGEF
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R8531 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141239499-141257564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141249592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 493 (I493T)
Ref Sequence ENSEMBL: ENSMUSP00000006618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006618] [ENSMUST00000125392] [ENSMUST00000135623] [ENSMUST00000138096] [ENSMUST00000141834] [ENSMUST00000147903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006618
AA Change: I493T

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006618
Gene: ENSMUSG00000028919
AA Change: I493T

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
RhoGEF 380 559 5.51e-43 SMART
PH 593 706 8.86e-6 SMART
SH3 718 775 5.16e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125392
Predicted Effect probably benign
Transcript: ENSMUST00000135623
SMART Domains Protein: ENSMUSP00000119846
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138096
Predicted Effect probably benign
Transcript: ENSMUST00000141834
Predicted Effect probably benign
Transcript: ENSMUST00000147903
SMART Domains Protein: ENSMUSP00000120088
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 147 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,066,421 R1506S probably benign Het
Acox2 T C 14: 8,247,960 T441A probably damaging Het
Adam6a A G 12: 113,545,297 E430G probably damaging Het
Afg3l2 T C 18: 67,407,369 E690G probably damaging Het
Alb A G 5: 90,464,014 I101V probably benign Het
Btnl2 T C 17: 34,358,054 M61T probably benign Het
Cyp2d11 A G 15: 82,389,228 Y481H probably benign Het
Ddx58 A G 4: 40,225,596 probably null Het
Dennd4c T C 4: 86,826,082 probably null Het
Dhx9 C A 1: 153,458,436 V993F possibly damaging Het
Dlk1 A G 12: 109,458,140 Q110R probably null Het
Dmp1 A C 5: 104,212,403 D315A probably damaging Het
Dnah3 T C 7: 119,951,368 K3243E probably damaging Het
Dsc3 T C 18: 19,968,392 N648S probably benign Het
Dsc3 C T 18: 19,981,217 D327N probably damaging Het
Egr4 T C 6: 85,512,124 D318G probably damaging Het
Fiz1 A T 7: 5,009,164 C118* probably null Het
Flad1 A C 3: 89,403,210 Y479D probably damaging Het
Flnb T C 14: 7,929,939 F2023S probably damaging Het
Glp1r T C 17: 30,924,557 L189P probably damaging Het
Gm13103 T A 4: 143,853,031 D395E probably benign Het
Grm5 A T 7: 88,130,516 T1055S probably benign Het
Gucy1a1 A G 3: 82,111,161 I123T probably benign Het
Ifnar1 T A 16: 91,495,456 C199* probably null Het
Lepr A T 4: 101,765,415 Y464F probably damaging Het
Mamdc4 G T 2: 25,567,718 Q452K possibly damaging Het
Map2k6 A G 11: 110,399,349 probably benign Het
Mphosph10 T C 7: 64,384,328 I429V possibly damaging Het
Neb T A 2: 52,291,062 M1178L possibly damaging Het
Npc2 C A 12: 84,760,838 R82L probably benign Het
Olfm5 A T 7: 104,153,822 M478K probably benign Het
Olfr1109 G T 2: 87,093,326 Q24K probably benign Het
Olfr177 A C 16: 58,872,653 L166V probably damaging Het
Osbpl9 T C 4: 109,156,711 D62G probably damaging Het
Otog C T 7: 46,252,049 R391C probably damaging Het
Pdzd3 T C 9: 44,248,373 E442G probably damaging Het
Plppr4 T C 3: 117,321,943 Y755C probably damaging Het
Pnpla8 T A 12: 44,311,585 F708I possibly damaging Het
Pom121l12 A T 11: 14,599,932 T213S probably benign Het
Rabep1 T C 11: 70,908,506 S278P probably benign Het
Rnf213 C G 11: 119,474,205 Q4563E probably benign Het
Rttn C A 18: 89,113,343 R1949S probably benign Het
Rwdd3 T C 3: 121,159,139 I140V probably benign Het
Serpinb6a A T 13: 33,931,479 M53K probably damaging Het
Serpinb9g A T 13: 33,492,913 D226V possibly damaging Het
Serpind1 A T 16: 17,342,983 Y459F probably damaging Het
Skor2 T C 18: 76,858,874 V97A unknown Het
Slc26a4 C T 12: 31,549,912 probably null Het
Slc4a10 T C 2: 62,267,507 Y517H probably damaging Het
Sphkap A G 1: 83,277,188 W947R probably damaging Het
Sult3a2 T C 10: 33,777,243 D167G probably damaging Het
Supt16 A T 14: 52,172,563 M729K probably damaging Het
Tmem176b A G 6: 48,834,604 I37T possibly damaging Het
Tmem259 A G 10: 79,977,985 V423A probably damaging Het
Tmem62 G T 2: 121,007,052 L483F probably damaging Het
Tnfrsf13b T C 11: 61,140,951 probably null Het
Txk C A 5: 72,736,377 C20F possibly damaging Het
Ube2w A C 1: 16,602,318 N46K probably benign Het
Unc79 A T 12: 103,047,663 H300L probably damaging Het
Unc79 T A 12: 103,083,596 H920Q probably benign Het
Vmn1r16 A G 6: 57,322,915 Y241H probably damaging Het
Vmn2r100 A T 17: 19,522,197 I278F possibly damaging Het
Zcchc6 A T 13: 59,789,260 I1191K probably damaging Het
Zfp260 T A 7: 30,105,459 H261Q probably damaging Het
Other mutations in Arhgef19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Arhgef19 APN 4 141248983 unclassified probably benign
IGL02037:Arhgef19 APN 4 141246396 missense probably damaging 0.99
IGL03049:Arhgef19 APN 4 141254316 missense probably damaging 0.98
IGL03071:Arhgef19 APN 4 141249002 missense possibly damaging 0.88
IGL03098:Arhgef19 UTSW 4 141247568 missense possibly damaging 0.85
R0271:Arhgef19 UTSW 4 141250607 missense probably benign 0.00
R0319:Arhgef19 UTSW 4 141256399 missense possibly damaging 0.63
R1572:Arhgef19 UTSW 4 141254754 missense probably benign 0.10
R1633:Arhgef19 UTSW 4 141238560 unclassified probably benign
R1735:Arhgef19 UTSW 4 141249618 missense possibly damaging 0.55
R1752:Arhgef19 UTSW 4 141251043 missense probably benign 0.27
R1823:Arhgef19 UTSW 4 141249146 missense probably benign 0.01
R1889:Arhgef19 UTSW 4 141249313 missense probably damaging 1.00
R2138:Arhgef19 UTSW 4 141250800 missense probably damaging 1.00
R2280:Arhgef19 UTSW 4 141246516 missense probably benign 0.14
R3430:Arhgef19 UTSW 4 141256800 missense probably benign 0.03
R3954:Arhgef19 UTSW 4 141256334 missense probably damaging 1.00
R4158:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4160:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4995:Arhgef19 UTSW 4 141247515 splice site probably null
R5031:Arhgef19 UTSW 4 141250810 missense probably damaging 0.98
R5782:Arhgef19 UTSW 4 141256312 missense probably damaging 1.00
R5913:Arhgef19 UTSW 4 141249298 missense probably benign 0.03
R7614:Arhgef19 UTSW 4 141256779 missense possibly damaging 0.52
R8356:Arhgef19 UTSW 4 141250615 missense probably benign 0.25
R8456:Arhgef19 UTSW 4 141250615 missense probably benign 0.25
R8876:Arhgef19 UTSW 4 141247882 missense probably benign 0.28
R8931:Arhgef19 UTSW 4 141249292 missense probably damaging 0.98
R8947:Arhgef19 UTSW 4 141246307 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GAGTCTACCTGCCTTACGTCAC -3'
(R):5'- ACATGCTCGAAAGGCCACAG -3'

Sequencing Primer
(F):5'- CTGCTGTAGGAGGGGCTCTAC -3'
(R):5'- GGCCACAGACCATAGATTGCAG -3'
Posted On2021-01-18