Incidental Mutation 'R8531:Otog'
ID659048
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R8531 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46252049 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 391 (R391C)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: R391C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: R391C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,066,421 R1506S probably benign Het
Acox2 T C 14: 8,247,960 T441A probably damaging Het
Adam6a A G 12: 113,545,297 E430G probably damaging Het
Afg3l2 T C 18: 67,407,369 E690G probably damaging Het
Alb A G 5: 90,464,014 I101V probably benign Het
Arhgef19 T C 4: 141,249,592 I493T possibly damaging Het
Btnl2 T C 17: 34,358,054 M61T probably benign Het
Cyp2d11 A G 15: 82,389,228 Y481H probably benign Het
Ddx58 A G 4: 40,225,596 probably null Het
Dennd4c T C 4: 86,826,082 probably null Het
Dhx9 C A 1: 153,458,436 V993F possibly damaging Het
Dlk1 A G 12: 109,458,140 Q110R probably null Het
Dmp1 A C 5: 104,212,403 D315A probably damaging Het
Dnah3 T C 7: 119,951,368 K3243E probably damaging Het
Dsc3 C T 18: 19,981,217 D327N probably damaging Het
Dsc3 T C 18: 19,968,392 N648S probably benign Het
Egr4 T C 6: 85,512,124 D318G probably damaging Het
Fiz1 A T 7: 5,009,164 C118* probably null Het
Flad1 A C 3: 89,403,210 Y479D probably damaging Het
Flnb T C 14: 7,929,939 F2023S probably damaging Het
Glp1r T C 17: 30,924,557 L189P probably damaging Het
Gm13103 T A 4: 143,853,031 D395E probably benign Het
Grm5 A T 7: 88,130,516 T1055S probably benign Het
Gucy1a1 A G 3: 82,111,161 I123T probably benign Het
Ifnar1 T A 16: 91,495,456 C199* probably null Het
Lepr A T 4: 101,765,415 Y464F probably damaging Het
Mamdc4 G T 2: 25,567,718 Q452K possibly damaging Het
Map2k6 A G 11: 110,399,349 probably benign Het
Mphosph10 T C 7: 64,384,328 I429V possibly damaging Het
Neb T A 2: 52,291,062 M1178L possibly damaging Het
Npc2 C A 12: 84,760,838 R82L probably benign Het
Olfm5 A T 7: 104,153,822 M478K probably benign Het
Olfr1109 G T 2: 87,093,326 Q24K probably benign Het
Olfr177 A C 16: 58,872,653 L166V probably damaging Het
Osbpl9 T C 4: 109,156,711 D62G probably damaging Het
Pdzd3 T C 9: 44,248,373 E442G probably damaging Het
Plppr4 T C 3: 117,321,943 Y755C probably damaging Het
Pnpla8 T A 12: 44,311,585 F708I possibly damaging Het
Pom121l12 A T 11: 14,599,932 T213S probably benign Het
Rabep1 T C 11: 70,908,506 S278P probably benign Het
Rnf213 C G 11: 119,474,205 Q4563E probably benign Het
Rttn C A 18: 89,113,343 R1949S probably benign Het
Rwdd3 T C 3: 121,159,139 I140V probably benign Het
Serpinb6a A T 13: 33,931,479 M53K probably damaging Het
Serpinb9g A T 13: 33,492,913 D226V possibly damaging Het
Serpind1 A T 16: 17,342,983 Y459F probably damaging Het
Skor2 T C 18: 76,858,874 V97A unknown Het
Slc26a4 C T 12: 31,549,912 probably null Het
Slc4a10 T C 2: 62,267,507 Y517H probably damaging Het
Sphkap A G 1: 83,277,188 W947R probably damaging Het
Sult3a2 T C 10: 33,777,243 D167G probably damaging Het
Supt16 A T 14: 52,172,563 M729K probably damaging Het
Tmem176b A G 6: 48,834,604 I37T possibly damaging Het
Tmem259 A G 10: 79,977,985 V423A probably damaging Het
Tmem62 G T 2: 121,007,052 L483F probably damaging Het
Tnfrsf13b T C 11: 61,140,951 probably null Het
Txk C A 5: 72,736,377 C20F possibly damaging Het
Ube2w A C 1: 16,602,318 N46K probably benign Het
Unc79 T A 12: 103,083,596 H920Q probably benign Het
Unc79 A T 12: 103,047,663 H300L probably damaging Het
Vmn1r16 A G 6: 57,322,915 Y241H probably damaging Het
Vmn2r100 A T 17: 19,522,197 I278F possibly damaging Het
Zcchc6 A T 13: 59,789,260 I1191K probably damaging Het
Zfp260 T A 7: 30,105,459 H261Q probably damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
R0636_otog_678 UTSW 7 46264228 critical splice donor site probably null
BB010:Otog UTSW 7 46310147 missense probably damaging 1.00
BB020:Otog UTSW 7 46310147 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
R7806:Otog UTSW 7 46285776 missense probably benign
R7933:Otog UTSW 7 46310147 missense probably damaging 1.00
R8021:Otog UTSW 7 46267342 missense probably damaging 0.98
R8082:Otog UTSW 7 46289719 missense probably damaging 1.00
R8772:Otog UTSW 7 46284928 missense probably damaging 1.00
RF024:Otog UTSW 7 46287669 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Z1177:Otog UTSW 7 46262852 missense possibly damaging 0.80
Z1177:Otog UTSW 7 46274538 missense probably damaging 1.00
Z1177:Otog UTSW 7 46289740 missense probably damaging 1.00
Z1177:Otog UTSW 7 46309985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTGCTCTGACATTCTGAG -3'
(R):5'- TCTGTTATAAGGATGGAACCTCAG -3'

Sequencing Primer
(F):5'- GAGAGTGTTTACAGCAACAGTTCTC -3'
(R):5'- TGGAACCTCAGAAGTTAAGGTTC -3'
Posted On2021-01-18