Incidental Mutation 'R8531:Rabep1'
ID659058
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Namerabaptin, RAB GTPase binding effector protein 1
Synonymsneurocrescin, RAB5 effector protein, rabaptin-5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R8531 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70844778-70943105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70908506 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000136069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect probably benign
Transcript: ENSMUST00000076270
AA Change: S362P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: S362P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081362
AA Change: S322P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: S322P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100928
AA Change: S362P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: S362P

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108533
AA Change: S362P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: S362P

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177731
AA Change: S278P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: S278P

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178245
AA Change: S319P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: S319P

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,066,421 R1506S probably benign Het
Acox2 T C 14: 8,247,960 T441A probably damaging Het
Adam6a A G 12: 113,545,297 E430G probably damaging Het
Afg3l2 T C 18: 67,407,369 E690G probably damaging Het
Alb A G 5: 90,464,014 I101V probably benign Het
Arhgef19 T C 4: 141,249,592 I493T possibly damaging Het
Btnl2 T C 17: 34,358,054 M61T probably benign Het
Cyp2d11 A G 15: 82,389,228 Y481H probably benign Het
Ddx58 A G 4: 40,225,596 probably null Het
Dennd4c T C 4: 86,826,082 probably null Het
Dhx9 C A 1: 153,458,436 V993F possibly damaging Het
Dlk1 A G 12: 109,458,140 Q110R probably null Het
Dmp1 A C 5: 104,212,403 D315A probably damaging Het
Dnah3 T C 7: 119,951,368 K3243E probably damaging Het
Dsc3 T C 18: 19,968,392 N648S probably benign Het
Dsc3 C T 18: 19,981,217 D327N probably damaging Het
Egr4 T C 6: 85,512,124 D318G probably damaging Het
Fiz1 A T 7: 5,009,164 C118* probably null Het
Flad1 A C 3: 89,403,210 Y479D probably damaging Het
Flnb T C 14: 7,929,939 F2023S probably damaging Het
Glp1r T C 17: 30,924,557 L189P probably damaging Het
Gm13103 T A 4: 143,853,031 D395E probably benign Het
Grm5 A T 7: 88,130,516 T1055S probably benign Het
Gucy1a1 A G 3: 82,111,161 I123T probably benign Het
Ifnar1 T A 16: 91,495,456 C199* probably null Het
Lepr A T 4: 101,765,415 Y464F probably damaging Het
Mamdc4 G T 2: 25,567,718 Q452K possibly damaging Het
Map2k6 A G 11: 110,399,349 probably benign Het
Mphosph10 T C 7: 64,384,328 I429V possibly damaging Het
Neb T A 2: 52,291,062 M1178L possibly damaging Het
Npc2 C A 12: 84,760,838 R82L probably benign Het
Olfm5 A T 7: 104,153,822 M478K probably benign Het
Olfr1109 G T 2: 87,093,326 Q24K probably benign Het
Olfr177 A C 16: 58,872,653 L166V probably damaging Het
Osbpl9 T C 4: 109,156,711 D62G probably damaging Het
Otog C T 7: 46,252,049 R391C probably damaging Het
Pdzd3 T C 9: 44,248,373 E442G probably damaging Het
Plppr4 T C 3: 117,321,943 Y755C probably damaging Het
Pnpla8 T A 12: 44,311,585 F708I possibly damaging Het
Pom121l12 A T 11: 14,599,932 T213S probably benign Het
Rnf213 C G 11: 119,474,205 Q4563E probably benign Het
Rttn C A 18: 89,113,343 R1949S probably benign Het
Rwdd3 T C 3: 121,159,139 I140V probably benign Het
Serpinb6a A T 13: 33,931,479 M53K probably damaging Het
Serpinb9g A T 13: 33,492,913 D226V possibly damaging Het
Serpind1 A T 16: 17,342,983 Y459F probably damaging Het
Skor2 T C 18: 76,858,874 V97A unknown Het
Slc26a4 C T 12: 31,549,912 probably null Het
Slc4a10 T C 2: 62,267,507 Y517H probably damaging Het
Sphkap A G 1: 83,277,188 W947R probably damaging Het
Sult3a2 T C 10: 33,777,243 D167G probably damaging Het
Supt16 A T 14: 52,172,563 M729K probably damaging Het
Tmem176b A G 6: 48,834,604 I37T possibly damaging Het
Tmem259 A G 10: 79,977,985 V423A probably damaging Het
Tmem62 G T 2: 121,007,052 L483F probably damaging Het
Tnfrsf13b T C 11: 61,140,951 probably null Het
Txk C A 5: 72,736,377 C20F possibly damaging Het
Ube2w A C 1: 16,602,318 N46K probably benign Het
Unc79 A T 12: 103,047,663 H300L probably damaging Het
Unc79 T A 12: 103,083,596 H920Q probably benign Het
Vmn1r16 A G 6: 57,322,915 Y241H probably damaging Het
Vmn2r100 A T 17: 19,522,197 I278F possibly damaging Het
Zcchc6 A T 13: 59,789,260 I1191K probably damaging Het
Zfp260 T A 7: 30,105,459 H261Q probably damaging Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70925781 missense probably benign 0.00
IGL02022:Rabep1 APN 11 70934559 missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70923197 nonsense probably null
IGL02428:Rabep1 APN 11 70917480 missense probably benign 0.00
IGL02566:Rabep1 APN 11 70917714 missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70874746 missense probably benign 0.00
F5770:Rabep1 UTSW 11 70937516 splice site probably benign
P0042:Rabep1 UTSW 11 70884975 splice site probably benign
PIT4495001:Rabep1 UTSW 11 70917579 missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70919207 missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70886998 splice site probably null
R0477:Rabep1 UTSW 11 70920907 missense probably damaging 1.00
R0727:Rabep1 UTSW 11 70900492 nonsense probably null
R1732:Rabep1 UTSW 11 70904641 missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70904658 missense probably damaging 1.00
R2203:Rabep1 UTSW 11 70934574 missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70917367 missense probably benign 0.12
R4229:Rabep1 UTSW 11 70908434 missense probably benign
R4573:Rabep1 UTSW 11 70917751 missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70908468 missense probably benign 0.18
R5130:Rabep1 UTSW 11 70904731 missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70904628 nonsense probably null
R5379:Rabep1 UTSW 11 70908421 missense probably damaging 1.00
R5525:Rabep1 UTSW 11 70923146 missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70917529 missense probably damaging 1.00
R6283:Rabep1 UTSW 11 70917679 missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70935121 missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70940386 missense possibly damaging 0.88
R6988:Rabep1 UTSW 11 70934537 missense probably damaging 0.96
R7235:Rabep1 UTSW 11 70940464 missense probably benign 0.43
R7241:Rabep1 UTSW 11 70939989 missense probably damaging 1.00
R7453:Rabep1 UTSW 11 70917660 missense probably damaging 1.00
R7955:Rabep1 UTSW 11 70917441 missense probably damaging 0.96
R8175:Rabep1 UTSW 11 70884929 missense probably damaging 1.00
R8314:Rabep1 UTSW 11 70893660 missense possibly damaging 0.93
R8461:Rabep1 UTSW 11 70884855 missense possibly damaging 0.56
R8481:Rabep1 UTSW 11 70887127 missense probably damaging 1.00
R8530:Rabep1 UTSW 11 70919242 missense probably damaging 1.00
Z1186:Rabep1 UTSW 11 70940084 frame shift probably null
Z1187:Rabep1 UTSW 11 70940084 frame shift probably null
Z1188:Rabep1 UTSW 11 70940084 frame shift probably null
Z1189:Rabep1 UTSW 11 70940084 frame shift probably null
Z1190:Rabep1 UTSW 11 70940084 frame shift probably null
Z1191:Rabep1 UTSW 11 70940084 frame shift probably null
Z1192:Rabep1 UTSW 11 70940084 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTACATATAGATTACCCGGGTAAC -3'
(R):5'- TTTCCACACAAACAAGGTGC -3'

Sequencing Primer
(F):5'- TTACCCGGGTAACTAAATGGTGC -3'
(R):5'- TTAATTGAGGTACAAGGGCCCACTC -3'
Posted On2021-01-18