Incidental Mutation 'R8531:Serpinb6a'
ID659069
Institutional Source Beutler Lab
Gene Symbol Serpinb6a
Ensembl Gene ENSMUSG00000060147
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonymsovalbumin, D330015H01Rik, 4930482L21Rik, Spi3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8531 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location33917918-34002794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33931479 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 53 (M53K)
Ref Sequence ENSEMBL: ENSMUSP00000126162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000164627] [ENSMUST00000166354] [ENSMUST00000167163] [ENSMUST00000167237] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000168400] [ENSMUST00000170991] [ENSMUST00000171034] [ENSMUST00000171252]
Predicted Effect probably damaging
Transcript: ENSMUST00000017188
AA Change: M74K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: M74K

DomainStartEndE-ValueType
SERPIN 34 399 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043552
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076532
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164627
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127224
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 144 1.26e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166354
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
Pfam:Serpin 6 66 3.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167163
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167237
Predicted Effect probably damaging
Transcript: ENSMUST00000167260
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 193 1.34e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168350
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 162 9.24e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168400
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
Pfam:Serpin 6 120 3.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170991
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131900
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
Pfam:Serpin 6 73 2.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171034
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171252
AA Change: M53K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147
AA Change: M53K

DomainStartEndE-ValueType
SERPIN 13 188 4.71e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,066,421 R1506S probably benign Het
Acox2 T C 14: 8,247,960 T441A probably damaging Het
Adam6a A G 12: 113,545,297 E430G probably damaging Het
Afg3l2 T C 18: 67,407,369 E690G probably damaging Het
Alb A G 5: 90,464,014 I101V probably benign Het
Arhgef19 T C 4: 141,249,592 I493T possibly damaging Het
Btnl2 T C 17: 34,358,054 M61T probably benign Het
Cyp2d11 A G 15: 82,389,228 Y481H probably benign Het
Ddx58 A G 4: 40,225,596 probably null Het
Dennd4c T C 4: 86,826,082 probably null Het
Dhx9 C A 1: 153,458,436 V993F possibly damaging Het
Dlk1 A G 12: 109,458,140 Q110R probably null Het
Dmp1 A C 5: 104,212,403 D315A probably damaging Het
Dnah3 T C 7: 119,951,368 K3243E probably damaging Het
Dsc3 T C 18: 19,968,392 N648S probably benign Het
Dsc3 C T 18: 19,981,217 D327N probably damaging Het
Egr4 T C 6: 85,512,124 D318G probably damaging Het
Fiz1 A T 7: 5,009,164 C118* probably null Het
Flad1 A C 3: 89,403,210 Y479D probably damaging Het
Flnb T C 14: 7,929,939 F2023S probably damaging Het
Glp1r T C 17: 30,924,557 L189P probably damaging Het
Gm13103 T A 4: 143,853,031 D395E probably benign Het
Grm5 A T 7: 88,130,516 T1055S probably benign Het
Gucy1a1 A G 3: 82,111,161 I123T probably benign Het
Ifnar1 T A 16: 91,495,456 C199* probably null Het
Lepr A T 4: 101,765,415 Y464F probably damaging Het
Mamdc4 G T 2: 25,567,718 Q452K possibly damaging Het
Map2k6 A G 11: 110,399,349 probably benign Het
Mphosph10 T C 7: 64,384,328 I429V possibly damaging Het
Neb T A 2: 52,291,062 M1178L possibly damaging Het
Npc2 C A 12: 84,760,838 R82L probably benign Het
Olfm5 A T 7: 104,153,822 M478K probably benign Het
Olfr1109 G T 2: 87,093,326 Q24K probably benign Het
Olfr177 A C 16: 58,872,653 L166V probably damaging Het
Osbpl9 T C 4: 109,156,711 D62G probably damaging Het
Otog C T 7: 46,252,049 R391C probably damaging Het
Pdzd3 T C 9: 44,248,373 E442G probably damaging Het
Plppr4 T C 3: 117,321,943 Y755C probably damaging Het
Pnpla8 T A 12: 44,311,585 F708I possibly damaging Het
Pom121l12 A T 11: 14,599,932 T213S probably benign Het
Rabep1 T C 11: 70,908,506 S278P probably benign Het
Rnf213 C G 11: 119,474,205 Q4563E probably benign Het
Rttn C A 18: 89,113,343 R1949S probably benign Het
Rwdd3 T C 3: 121,159,139 I140V probably benign Het
Serpinb9g A T 13: 33,492,913 D226V possibly damaging Het
Serpind1 A T 16: 17,342,983 Y459F probably damaging Het
Skor2 T C 18: 76,858,874 V97A unknown Het
Slc26a4 C T 12: 31,549,912 probably null Het
Slc4a10 T C 2: 62,267,507 Y517H probably damaging Het
Sphkap A G 1: 83,277,188 W947R probably damaging Het
Sult3a2 T C 10: 33,777,243 D167G probably damaging Het
Supt16 A T 14: 52,172,563 M729K probably damaging Het
Tmem176b A G 6: 48,834,604 I37T possibly damaging Het
Tmem259 A G 10: 79,977,985 V423A probably damaging Het
Tmem62 G T 2: 121,007,052 L483F probably damaging Het
Tnfrsf13b T C 11: 61,140,951 probably null Het
Txk C A 5: 72,736,377 C20F possibly damaging Het
Ube2w A C 1: 16,602,318 N46K probably benign Het
Unc79 A T 12: 103,047,663 H300L probably damaging Het
Unc79 T A 12: 103,083,596 H920Q probably benign Het
Vmn1r16 A G 6: 57,322,915 Y241H probably damaging Het
Vmn2r100 A T 17: 19,522,197 I278F possibly damaging Het
Zcchc6 A T 13: 59,789,260 I1191K probably damaging Het
Zfp260 T A 7: 30,105,459 H261Q probably damaging Het
Other mutations in Serpinb6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Serpinb6a APN 13 33931512 missense possibly damaging 0.54
IGL01356:Serpinb6a APN 13 33925417 missense possibly damaging 0.76
IGL01458:Serpinb6a APN 13 33930081 missense possibly damaging 0.56
IGL01539:Serpinb6a APN 13 33930134 missense probably damaging 1.00
IGL02795:Serpinb6a APN 13 33931593 missense probably damaging 1.00
IGL02885:Serpinb6a APN 13 33918799 missense probably benign 0.11
IGL02971:Serpinb6a APN 13 33931470 critical splice donor site probably null
R0829:Serpinb6a UTSW 13 33935701 utr 5 prime probably benign
R1324:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R2232:Serpinb6a UTSW 13 33925320 missense probably damaging 0.97
R3498:Serpinb6a UTSW 13 33918781 missense probably damaging 0.99
R4982:Serpinb6a UTSW 13 33918874 missense probably damaging 0.99
R5131:Serpinb6a UTSW 13 33918872 missense probably benign 0.42
R5132:Serpinb6a UTSW 13 33918322 missense probably benign 0.00
R6149:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R6427:Serpinb6a UTSW 13 33918259 missense probably damaging 0.99
R6937:Serpinb6a UTSW 13 33918818 missense possibly damaging 0.81
R7806:Serpinb6a UTSW 13 33935565 splice site probably null
R7830:Serpinb6a UTSW 13 33930047 missense probably benign 0.09
R7948:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R7949:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R8773:Serpinb6a UTSW 13 33931560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCACCAGTGAGGCAGTG -3'
(R):5'- GGAGAGTGAAGATGTGTCCTAC -3'

Sequencing Primer
(F):5'- GGGGTCTTAACAAGGATAATACACC -3'
(R):5'- CTACACATCAGCCTGTATTTATGTG -3'
Posted On2021-01-18