Mutagenetix > Incidental Mutations

Incidental Mutation 'R8531:Afg3l2'

659084

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8531 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67407369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 690 (E690G)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001513] [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000001513

SMART Domains

Protein: ENSMUSP00000001513
Gene: ENSMUSG00000001473

Domain	Start	End	E-Value	Type
Tubulin	47	244	6.2e-66	SMART
Tubulin_C	246	383	3.57e-48	SMART
low complexity region	432	447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: E690G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: E690G

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	T	15: 82,066,421	R1506S	probably benign	Het
Acox2	T	C	14: 8,247,960	T441A	probably damaging	Het
Adam6a	A	G	12: 113,545,297	E430G	probably damaging	Het
Alb	A	G	5: 90,464,014	I101V	probably benign	Het
Arhgef19	T	C	4: 141,249,592	I493T	possibly damaging	Het
Btnl2	T	C	17: 34,358,054	M61T	probably benign	Het
Cyp2d11	A	G	15: 82,389,228	Y481H	probably benign	Het
Ddx58	A	G	4: 40,225,596		probably null	Het
Dennd4c	T	C	4: 86,826,082		probably null	Het
Dhx9	C	A	1: 153,458,436	V993F	possibly damaging	Het
Dlk1	A	G	12: 109,458,140	Q110R	probably null	Het
Dmp1	A	C	5: 104,212,403	D315A	probably damaging	Het
Dnah3	T	C	7: 119,951,368	K3243E	probably damaging	Het
Dsc3	T	C	18: 19,968,392	N648S	probably benign	Het
Dsc3	C	T	18: 19,981,217	D327N	probably damaging	Het
Egr4	T	C	6: 85,512,124	D318G	probably damaging	Het
Fiz1	A	T	7: 5,009,164	C118*	probably null	Het
Flad1	A	C	3: 89,403,210	Y479D	probably damaging	Het
Flnb	T	C	14: 7,929,939	F2023S	probably damaging	Het
Glp1r	T	C	17: 30,924,557	L189P	probably damaging	Het
Gm13103	T	A	4: 143,853,031	D395E	probably benign	Het
Grm5	A	T	7: 88,130,516	T1055S	probably benign	Het
Gucy1a1	A	G	3: 82,111,161	I123T	probably benign	Het
Ifnar1	T	A	16: 91,495,456	C199*	probably null	Het
Lepr	A	T	4: 101,765,415	Y464F	probably damaging	Het
Mamdc4	G	T	2: 25,567,718	Q452K	possibly damaging	Het
Map2k6	A	G	11: 110,399,349		probably benign	Het
Mphosph10	T	C	7: 64,384,328	I429V	possibly damaging	Het
Neb	T	A	2: 52,291,062	M1178L	possibly damaging	Het
Npc2	C	A	12: 84,760,838	R82L	probably benign	Het
Olfm5	A	T	7: 104,153,822	M478K	probably benign	Het
Olfr1109	G	T	2: 87,093,326	Q24K	probably benign	Het
Olfr177	A	C	16: 58,872,653	L166V	probably damaging	Het
Osbpl9	T	C	4: 109,156,711	D62G	probably damaging	Het
Otog	C	T	7: 46,252,049	R391C	probably damaging	Het
Pdzd3	T	C	9: 44,248,373	E442G	probably damaging	Het
Plppr4	T	C	3: 117,321,943	Y755C	probably damaging	Het
Pnpla8	T	A	12: 44,311,585	F708I	possibly damaging	Het
Pom121l12	A	T	11: 14,599,932	T213S	probably benign	Het
Rabep1	T	C	11: 70,908,506	S278P	probably benign	Het
Rnf213	C	G	11: 119,474,205	Q4563E	probably benign	Het
Rttn	C	A	18: 89,113,343	R1949S	probably benign	Het
Rwdd3	T	C	3: 121,159,139	I140V	probably benign	Het
Serpinb6a	A	T	13: 33,931,479	M53K	probably damaging	Het
Serpinb9g	A	T	13: 33,492,913	D226V	possibly damaging	Het
Serpind1	A	T	16: 17,342,983	Y459F	probably damaging	Het
Skor2	T	C	18: 76,858,874	V97A	unknown	Het
Slc26a4	C	T	12: 31,549,912		probably null	Het
Slc4a10	T	C	2: 62,267,507	Y517H	probably damaging	Het
Sphkap	A	G	1: 83,277,188	W947R	probably damaging	Het
Sult3a2	T	C	10: 33,777,243	D167G	probably damaging	Het
Supt16	A	T	14: 52,172,563	M729K	probably damaging	Het
Tmem176b	A	G	6: 48,834,604	I37T	possibly damaging	Het
Tmem259	A	G	10: 79,977,985	V423A	probably damaging	Het
Tmem62	G	T	2: 121,007,052	L483F	probably damaging	Het
Tnfrsf13b	T	C	11: 61,140,951		probably null	Het
Txk	C	A	5: 72,736,377	C20F	possibly damaging	Het
Ube2w	A	C	1: 16,602,318	N46K	probably benign	Het
Unc79	A	T	12: 103,047,663	H300L	probably damaging	Het
Unc79	T	A	12: 103,083,596	H920Q	probably benign	Het
Vmn1r16	A	G	6: 57,322,915	Y241H	probably damaging	Het
Vmn2r100	A	T	17: 19,522,197	I278F	possibly damaging	Het
Zcchc6	A	T	13: 59,789,260	I1191K	probably damaging	Het
Zfp260	T	A	7: 30,105,459	H261Q	probably damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GCCACAGGAAGACACTTAGC -3'
(R):5'- TCCGGAACATACAGGGTGAAC -3'

Sequencing Primer
(F):5'- CTGGTCTACACAATGAGTTCCAGG -3'
(R):5'- CAGGGTGAACTTAATCATACTGC -3'

Posted On

2021-01-18