Incidental Mutation 'R8532:Kif12'
ID659095
Institutional Source Beutler Lab
Gene Symbol Kif12
Ensembl Gene ENSMUSG00000028357
Gene Namekinesin family member 12
SynonymsN-9 kinesin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R8532 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location63165630-63172131 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 63169419 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 276 (Q276*)
Ref Sequence ENSEMBL: ENSMUSP00000152690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]
Predicted Effect probably null
Transcript: ENSMUST00000030042
AA Change: Q276*
SMART Domains Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357
AA Change: Q276*

DomainStartEndE-ValueType
KISc 23 368 4.46e-108 SMART
coiled coil region 376 464 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124739
Predicted Effect probably benign
Transcript: ENSMUST00000154234
Predicted Effect probably null
Transcript: ENSMUST00000156618
AA Change: Q276*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C A 2: 69,259,691 V950L possibly damaging Het
Acsl6 T A 11: 54,327,175 V238E probably damaging Het
Adam2 C A 14: 66,056,521 A286S probably damaging Het
Ankrd17 A T 5: 90,264,820 I1215N probably damaging Het
Anxa2 T C 9: 69,467,312 Y24H probably benign Het
Brms1l T C 12: 55,844,479 L106P probably damaging Het
Cacna1e A T 1: 154,465,764 L1166Q probably damaging Het
Ccdc110 T C 8: 45,942,995 L641P probably damaging Het
Cep78 T A 19: 15,959,584 D586V possibly damaging Het
Chek1 T C 9: 36,719,692 D142G probably benign Het
Dennd1b A G 1: 139,170,174 probably benign Het
Eif2b5 T C 16: 20,505,206 V433A probably damaging Het
Enpep A T 3: 129,276,653 Y868* probably null Het
Fam149a T A 8: 45,348,954 T414S possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm3604 A T 13: 62,368,955 C530S possibly damaging Het
Gtf2e2 T C 8: 33,758,605 F140S probably damaging Het
Ighv1-63 T C 12: 115,495,650 D109G probably damaging Het
Igkv3-9 G C 6: 70,588,722 V102L possibly damaging Het
Lrba C T 3: 86,757,483 R557C probably damaging Het
Matn2 C A 15: 34,316,553 Q14K probably benign Het
Mical2 C A 7: 112,318,544 F369L probably damaging Het
Olfr1158 A G 2: 87,990,569 T153A probably damaging Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr675 T C 7: 105,024,566 Y138C probably damaging Het
Pramel1 A G 4: 143,398,555 T350A probably benign Het
Rcbtb1 T A 14: 59,210,524 C72* probably null Het
Ros1 T G 10: 52,098,756 T1578P possibly damaging Het
Rps6kb2 A T 19: 4,159,244 I200N probably damaging Het
Slc17a4 C A 13: 23,904,735 W223L probably damaging Het
Slitrk5 A T 14: 111,679,477 M178L probably benign Het
Snrpa A G 7: 27,191,602 probably null Het
Syt10 C T 15: 89,792,686 E366K probably damaging Het
Tbc1d16 A G 11: 119,155,167 F484L probably benign Het
Tbc1d30 A T 10: 121,267,430 W566R probably damaging Het
Tcaf1 A T 6: 42,678,131 I551K probably damaging Het
Tdrd7 A G 4: 46,016,920 T654A probably damaging Het
Timm44 A T 8: 4,260,549 I401N possibly damaging Het
Xcl1 T A 1: 164,931,946 T62S probably damaging Het
Zbtb11 A T 16: 55,990,889 H470L probably benign Het
Zfp57 A G 17: 37,009,901 T213A possibly damaging Het
Zfp715 A C 7: 43,299,405 I377S possibly damaging Het
Zfp715 A T 7: 43,299,710 D275E probably benign Het
Other mutations in Kif12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Kif12 APN 4 63165884 missense probably damaging 0.99
IGL01377:Kif12 APN 4 63170725 missense probably damaging 1.00
IGL02232:Kif12 APN 4 63166495 missense probably benign 0.00
IGL02671:Kif12 APN 4 63170457 missense probably benign 0.05
IGL02719:Kif12 APN 4 63167796 missense probably benign
IGL03056:Kif12 APN 4 63166956 missense probably null 0.00
ANU05:Kif12 UTSW 4 63171423 small insertion probably benign
ANU23:Kif12 UTSW 4 63165884 missense probably damaging 0.99
ANU74:Kif12 UTSW 4 63171423 small insertion probably benign
ANU74:Kif12 UTSW 4 63171426 frame shift probably null
IGL02984:Kif12 UTSW 4 63171423 small insertion probably benign
R0401:Kif12 UTSW 4 63169525 splice site probably benign
R0927:Kif12 UTSW 4 63168773 missense possibly damaging 0.71
R1589:Kif12 UTSW 4 63166500 missense probably benign 0.00
R2178:Kif12 UTSW 4 63166959 missense probably benign 0.00
R2263:Kif12 UTSW 4 63169521 missense probably benign 0.00
R2372:Kif12 UTSW 4 63168559 missense possibly damaging 0.64
R2404:Kif12 UTSW 4 63170553 missense probably damaging 1.00
R3903:Kif12 UTSW 4 63167976 missense possibly damaging 0.73
R4126:Kif12 UTSW 4 63166437 missense probably benign 0.00
R4271:Kif12 UTSW 4 63170746 missense probably benign 0.39
R4386:Kif12 UTSW 4 63171218 missense probably damaging 1.00
R4750:Kif12 UTSW 4 63167783 missense probably damaging 0.99
R4945:Kif12 UTSW 4 63168493 critical splice donor site probably null
R5177:Kif12 UTSW 4 63167904 missense probably benign 0.13
R5421:Kif12 UTSW 4 63171428 missense probably benign 0.40
R5644:Kif12 UTSW 4 63165893 missense possibly damaging 0.75
R5757:Kif12 UTSW 4 63170518 missense probably damaging 1.00
R5772:Kif12 UTSW 4 63165941 missense probably damaging 1.00
R5858:Kif12 UTSW 4 63166410 missense probably benign 0.04
R5929:Kif12 UTSW 4 63168517 missense probably damaging 0.96
R6648:Kif12 UTSW 4 63171317 critical splice donor site probably null
R7007:Kif12 UTSW 4 63166480 missense probably benign
R7108:Kif12 UTSW 4 63171205 missense probably benign 0.15
R7171:Kif12 UTSW 4 63168694 missense probably damaging 1.00
R7852:Kif12 UTSW 4 63167989 missense probably benign 0.13
RF011:Kif12 UTSW 4 63171427 small insertion probably benign
RF031:Kif12 UTSW 4 63171425 small insertion probably benign
RF036:Kif12 UTSW 4 63171427 small insertion probably benign
RF039:Kif12 UTSW 4 63171425 small insertion probably benign
RF041:Kif12 UTSW 4 63171425 small insertion probably benign
T0975:Kif12 UTSW 4 63171423 small insertion probably benign
Z1088:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171997 missense possibly damaging 0.95
Z1177:Kif12 UTSW 4 63171423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCCTCAGACTTGATGCC -3'
(R):5'- TAAAACAACTTGGCTCTGTTGG -3'

Sequencing Primer
(F):5'- TCAGACTTGATGCCAGAACTCTAG -3'
(R):5'- GGAAACCTTTGACCTTGAGACACTG -3'
Posted On2021-01-18