Incidental Mutation 'R8532:Mical2'
ID659104
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms5330438E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R8532 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location112225856-112355194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112318544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 369 (F369L)
Ref Sequence ENSEMBL: ENSMUSP00000051163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
Predicted Effect probably damaging
Transcript: ENSMUST00000037991
AA Change: F369L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: F369L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050149
AA Change: F369L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: F369L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C A 2: 69,259,691 V950L possibly damaging Het
Acsl6 T A 11: 54,327,175 V238E probably damaging Het
Adam2 C A 14: 66,056,521 A286S probably damaging Het
Ankrd17 A T 5: 90,264,820 I1215N probably damaging Het
Anxa2 T C 9: 69,467,312 Y24H probably benign Het
Brms1l T C 12: 55,844,479 L106P probably damaging Het
Cacna1e A T 1: 154,465,764 L1166Q probably damaging Het
Ccdc110 T C 8: 45,942,995 L641P probably damaging Het
Cep78 T A 19: 15,959,584 D586V possibly damaging Het
Chek1 T C 9: 36,719,692 D142G probably benign Het
Dennd1b A G 1: 139,170,174 probably benign Het
Eif2b5 T C 16: 20,505,206 V433A probably damaging Het
Enpep A T 3: 129,276,653 Y868* probably null Het
Fam149a T A 8: 45,348,954 T414S possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm3604 A T 13: 62,368,955 C530S possibly damaging Het
Gtf2e2 T C 8: 33,758,605 F140S probably damaging Het
Ighv1-63 T C 12: 115,495,650 D109G probably damaging Het
Igkv3-9 G C 6: 70,588,722 V102L possibly damaging Het
Kif12 G A 4: 63,169,419 Q276* probably null Het
Lrba C T 3: 86,757,483 R557C probably damaging Het
Matn2 C A 15: 34,316,553 Q14K probably benign Het
Olfr1158 A G 2: 87,990,569 T153A probably damaging Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr675 T C 7: 105,024,566 Y138C probably damaging Het
Pramel1 A G 4: 143,398,555 T350A probably benign Het
Rcbtb1 T A 14: 59,210,524 C72* probably null Het
Ros1 T G 10: 52,098,756 T1578P possibly damaging Het
Rps6kb2 A T 19: 4,159,244 I200N probably damaging Het
Slc17a4 C A 13: 23,904,735 W223L probably damaging Het
Slitrk5 A T 14: 111,679,477 M178L probably benign Het
Snrpa A G 7: 27,191,602 probably null Het
Syt10 C T 15: 89,792,686 E366K probably damaging Het
Tbc1d16 A G 11: 119,155,167 F484L probably benign Het
Tbc1d30 A T 10: 121,267,430 W566R probably damaging Het
Tcaf1 A T 6: 42,678,131 I551K probably damaging Het
Tdrd7 A G 4: 46,016,920 T654A probably damaging Het
Timm44 A T 8: 4,260,549 I401N possibly damaging Het
Xcl1 T A 1: 164,931,946 T62S probably damaging Het
Zbtb11 A T 16: 55,990,889 H470L probably benign Het
Zfp57 A G 17: 37,009,901 T213A possibly damaging Het
Zfp715 A C 7: 43,299,405 I377S possibly damaging Het
Zfp715 A T 7: 43,299,710 D275E probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1542:Mical2 UTSW 7 112309468 missense probably damaging 1.00
R1740:Mical2 UTSW 7 112333836 missense probably benign
R1855:Mical2 UTSW 7 112345282 missense probably benign 0.21
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R2418:Mical2 UTSW 7 112320734 critical splice donor site probably null
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6087:Mical2 UTSW 7 112318485 nonsense probably null
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7724:Mical2 UTSW 7 112323626 missense probably damaging 1.00
R7747:Mical2 UTSW 7 112333839 missense probably benign 0.02
R7818:Mical2 UTSW 7 112345307 missense probably damaging 1.00
R8022:Mical2 UTSW 7 112303767 missense probably damaging 1.00
R8429:Mical2 UTSW 7 112345253 missense probably benign 0.01
R8505:Mical2 UTSW 7 112319800 missense probably benign 0.02
R8862:Mical2 UTSW 7 112311367 missense probably damaging 1.00
RF008:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCCTTCTGATCCACAG -3'
(R):5'- TGTTGGCAGAGGCTATGAGC -3'

Sequencing Primer
(F):5'- CCTTCTGATCCACAGTGGGTG -3'
(R):5'- CCTGAGAACAGATCCATAGGTCTG -3'
Posted On2021-01-18