Incidental Mutation 'R8532:Olfr45'
ID659105
Institutional Source Beutler Lab
Gene Symbol Olfr45
Ensembl Gene ENSMUSG00000066122
Gene Nameolfactory receptor 45
SynonymsIB6, GA_x6K02T2PBJ9-42837030-42837962, MOR253-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8532 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140681951-140696845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140691799 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 298 (V298A)
Ref Sequence ENSEMBL: ENSMUSP00000149309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084454] [ENSMUST00000210241] [ENSMUST00000214637]
Predicted Effect probably damaging
Transcript: ENSMUST00000084454
AA Change: V298A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081492
Gene: ENSMUSG00000066122
AA Change: V298A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 176 1.2e-7 PFAM
Pfam:7tm_1 42 291 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210241
AA Change: V298A
Predicted Effect probably damaging
Transcript: ENSMUST00000214637
AA Change: V298A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C A 2: 69,259,691 V950L possibly damaging Het
Acsl6 T A 11: 54,327,175 V238E probably damaging Het
Adam2 C A 14: 66,056,521 A286S probably damaging Het
Ankrd17 A T 5: 90,264,820 I1215N probably damaging Het
Anxa2 T C 9: 69,467,312 Y24H probably benign Het
Brms1l T C 12: 55,844,479 L106P probably damaging Het
Cacna1e A T 1: 154,465,764 L1166Q probably damaging Het
Ccdc110 T C 8: 45,942,995 L641P probably damaging Het
Cep78 T A 19: 15,959,584 D586V possibly damaging Het
Chek1 T C 9: 36,719,692 D142G probably benign Het
Dennd1b A G 1: 139,170,174 probably benign Het
Eif2b5 T C 16: 20,505,206 V433A probably damaging Het
Enpep A T 3: 129,276,653 Y868* probably null Het
Fam149a T A 8: 45,348,954 T414S possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm3604 A T 13: 62,368,955 C530S possibly damaging Het
Gtf2e2 T C 8: 33,758,605 F140S probably damaging Het
Ighv1-63 T C 12: 115,495,650 D109G probably damaging Het
Igkv3-9 G C 6: 70,588,722 V102L possibly damaging Het
Kif12 G A 4: 63,169,419 Q276* probably null Het
Lrba C T 3: 86,757,483 R557C probably damaging Het
Matn2 C A 15: 34,316,553 Q14K probably benign Het
Mical2 C A 7: 112,318,544 F369L probably damaging Het
Olfr1158 A G 2: 87,990,569 T153A probably damaging Het
Olfr675 T C 7: 105,024,566 Y138C probably damaging Het
Pramel1 A G 4: 143,398,555 T350A probably benign Het
Rcbtb1 T A 14: 59,210,524 C72* probably null Het
Ros1 T G 10: 52,098,756 T1578P possibly damaging Het
Rps6kb2 A T 19: 4,159,244 I200N probably damaging Het
Slc17a4 C A 13: 23,904,735 W223L probably damaging Het
Slitrk5 A T 14: 111,679,477 M178L probably benign Het
Snrpa A G 7: 27,191,602 probably null Het
Syt10 C T 15: 89,792,686 E366K probably damaging Het
Tbc1d16 A G 11: 119,155,167 F484L probably benign Het
Tbc1d30 A T 10: 121,267,430 W566R probably damaging Het
Tcaf1 A T 6: 42,678,131 I551K probably damaging Het
Tdrd7 A G 4: 46,016,920 T654A probably damaging Het
Timm44 A T 8: 4,260,549 I401N possibly damaging Het
Xcl1 T A 1: 164,931,946 T62S probably damaging Het
Zbtb11 A T 16: 55,990,889 H470L probably benign Het
Zfp57 A G 17: 37,009,901 T213A possibly damaging Het
Zfp715 A C 7: 43,299,405 I377S possibly damaging Het
Zfp715 A T 7: 43,299,710 D275E probably benign Het
Other mutations in Olfr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr45 APN 7 140691436 missense probably damaging 1.00
IGL01434:Olfr45 APN 7 140691618 missense probably damaging 1.00
IGL01697:Olfr45 APN 7 140691652 missense possibly damaging 0.61
IGL02167:Olfr45 APN 7 140691751 missense probably damaging 0.98
IGL02388:Olfr45 APN 7 140691111 missense probably benign 0.00
IGL03054:Olfr45 UTSW 7 140691710 missense probably benign 0.10
R0107:Olfr45 UTSW 7 140691345 missense probably benign
R0403:Olfr45 UTSW 7 140691309 missense possibly damaging 0.80
R1344:Olfr45 UTSW 7 140691799 missense probably damaging 0.98
R1859:Olfr45 UTSW 7 140691658 missense possibly damaging 0.80
R2871:Olfr45 UTSW 7 140691285 missense possibly damaging 0.95
R2871:Olfr45 UTSW 7 140691285 missense possibly damaging 0.95
R3611:Olfr45 UTSW 7 140691100 missense probably benign 0.01
R3915:Olfr45 UTSW 7 140690975 missense probably benign
R4551:Olfr45 UTSW 7 140691742 missense probably damaging 1.00
R4552:Olfr45 UTSW 7 140691742 missense probably damaging 1.00
R4627:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4628:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4629:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4990:Olfr45 UTSW 7 140691447 missense probably damaging 0.99
R5503:Olfr45 UTSW 7 140691396 missense probably benign 0.01
R7861:Olfr45 UTSW 7 140691571 missense probably damaging 1.00
R8077:Olfr45 UTSW 7 140691133 missense probably benign 0.16
R8268:Olfr45 UTSW 7 140691517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATTGCCAGCATCCTGC -3'
(R):5'- AATGGTCCAGTCCTTGCATCAG -3'

Sequencing Primer
(F):5'- AGGAAGGCCTTTTCTACCTGC -3'
(R):5'- GGCAAAGCCTTTCTAAAGCAG -3'
Posted On2021-01-18