Incidental Mutation 'R8532:Matn2'
ID659124
Institutional Source Beutler Lab
Gene Symbol Matn2
Ensembl Gene ENSMUSG00000022324
Gene Namematrilin 2
SynonymsCrtm2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8532 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location34306677-34436273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34316553 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 14 (Q14K)
Ref Sequence ENSEMBL: ENSMUSP00000154740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000226766] [ENSMUST00000227759] [ENSMUST00000228570]
Predicted Effect probably benign
Transcript: ENSMUST00000022947
AA Change: Q14K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: Q14K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 889 935 4.78e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163455
AA Change: Q14K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: Q14K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 908 955 7.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226766
AA Change: Q14K

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000227759
AA Change: Q14K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000228570
AA Change: Q14K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C A 2: 69,259,691 V950L possibly damaging Het
Acsl6 T A 11: 54,327,175 V238E probably damaging Het
Adam2 C A 14: 66,056,521 A286S probably damaging Het
Ankrd17 A T 5: 90,264,820 I1215N probably damaging Het
Anxa2 T C 9: 69,467,312 Y24H probably benign Het
Brms1l T C 12: 55,844,479 L106P probably damaging Het
Cacna1e A T 1: 154,465,764 L1166Q probably damaging Het
Ccdc110 T C 8: 45,942,995 L641P probably damaging Het
Cep78 T A 19: 15,959,584 D586V possibly damaging Het
Chek1 T C 9: 36,719,692 D142G probably benign Het
Dennd1b A G 1: 139,170,174 probably benign Het
Eif2b5 T C 16: 20,505,206 V433A probably damaging Het
Enpep A T 3: 129,276,653 Y868* probably null Het
Fam149a T A 8: 45,348,954 T414S possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm3604 A T 13: 62,368,955 C530S possibly damaging Het
Gtf2e2 T C 8: 33,758,605 F140S probably damaging Het
Ighv1-63 T C 12: 115,495,650 D109G probably damaging Het
Igkv3-9 G C 6: 70,588,722 V102L possibly damaging Het
Kif12 G A 4: 63,169,419 Q276* probably null Het
Lrba C T 3: 86,757,483 R557C probably damaging Het
Mical2 C A 7: 112,318,544 F369L probably damaging Het
Olfr1158 A G 2: 87,990,569 T153A probably damaging Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr675 T C 7: 105,024,566 Y138C probably damaging Het
Pramel1 A G 4: 143,398,555 T350A probably benign Het
Rcbtb1 T A 14: 59,210,524 C72* probably null Het
Ros1 T G 10: 52,098,756 T1578P possibly damaging Het
Rps6kb2 A T 19: 4,159,244 I200N probably damaging Het
Slc17a4 C A 13: 23,904,735 W223L probably damaging Het
Slitrk5 A T 14: 111,679,477 M178L probably benign Het
Snrpa A G 7: 27,191,602 probably null Het
Syt10 C T 15: 89,792,686 E366K probably damaging Het
Tbc1d16 A G 11: 119,155,167 F484L probably benign Het
Tbc1d30 A T 10: 121,267,430 W566R probably damaging Het
Tcaf1 A T 6: 42,678,131 I551K probably damaging Het
Tdrd7 A G 4: 46,016,920 T654A probably damaging Het
Timm44 A T 8: 4,260,549 I401N possibly damaging Het
Xcl1 T A 1: 164,931,946 T62S probably damaging Het
Zbtb11 A T 16: 55,990,889 H470L probably benign Het
Zfp57 A G 17: 37,009,901 T213A possibly damaging Het
Zfp715 A C 7: 43,299,405 I377S possibly damaging Het
Zfp715 A T 7: 43,299,710 D275E probably benign Het
Other mutations in Matn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Matn2 APN 15 34428470 missense probably damaging 1.00
IGL00392:Matn2 APN 15 34402856 missense probably benign 0.00
IGL01475:Matn2 APN 15 34316525 missense possibly damaging 0.94
IGL02223:Matn2 APN 15 34423718 missense probably benign 0.00
IGL02252:Matn2 APN 15 34316590 missense probably damaging 0.98
IGL02288:Matn2 APN 15 34422386 missense probably damaging 1.00
IGL02738:Matn2 APN 15 34388739 missense probably benign 0.07
IGL02927:Matn2 APN 15 34355655 missense probably damaging 1.00
IGL03331:Matn2 APN 15 34345357 missense probably damaging 1.00
Engorged UTSW 15 34426234 missense probably damaging 1.00
PIT4260001:Matn2 UTSW 15 34428731 missense possibly damaging 0.78
R0124:Matn2 UTSW 15 34426151 splice site probably benign
R0422:Matn2 UTSW 15 34435771 splice site probably null
R0449:Matn2 UTSW 15 34428541 missense probably damaging 1.00
R0606:Matn2 UTSW 15 34345150 missense probably damaging 1.00
R0655:Matn2 UTSW 15 34345200 missense probably benign 0.03
R0885:Matn2 UTSW 15 34316605 missense possibly damaging 0.67
R1384:Matn2 UTSW 15 34409810 missense probably benign 0.00
R1603:Matn2 UTSW 15 34388768 missense probably damaging 1.00
R1667:Matn2 UTSW 15 34378732 missense probably damaging 0.99
R1720:Matn2 UTSW 15 34345274 nonsense probably null
R1772:Matn2 UTSW 15 34428785 missense probably damaging 0.99
R2037:Matn2 UTSW 15 34433117 missense probably benign 0.00
R2107:Matn2 UTSW 15 34423759 missense probably damaging 1.00
R2240:Matn2 UTSW 15 34433063 missense probably damaging 1.00
R3933:Matn2 UTSW 15 34345420 splice site probably null
R3963:Matn2 UTSW 15 34388791 nonsense probably null
R4648:Matn2 UTSW 15 34428533 missense probably damaging 1.00
R4695:Matn2 UTSW 15 34402925 missense probably damaging 1.00
R4817:Matn2 UTSW 15 34423799 missense probably damaging 1.00
R4935:Matn2 UTSW 15 34428685 missense probably damaging 1.00
R5105:Matn2 UTSW 15 34355668 missense possibly damaging 0.95
R5177:Matn2 UTSW 15 34433514 missense possibly damaging 0.58
R5717:Matn2 UTSW 15 34399091 nonsense probably null
R5760:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R5776:Matn2 UTSW 15 34431619 missense probably damaging 1.00
R5842:Matn2 UTSW 15 34399056 missense probably damaging 0.99
R5917:Matn2 UTSW 15 34409766 nonsense probably null
R5964:Matn2 UTSW 15 34410165 missense probably damaging 1.00
R6265:Matn2 UTSW 15 34399155 missense probably damaging 1.00
R6272:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R6332:Matn2 UTSW 15 34423755 missense probably benign 0.00
R6457:Matn2 UTSW 15 34426234 missense probably damaging 1.00
R7351:Matn2 UTSW 15 34345336 missense probably damaging 0.97
R7660:Matn2 UTSW 15 34402946 missense probably benign 0.00
R7660:Matn2 UTSW 15 34423728 nonsense probably null
R7775:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R7778:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R8007:Matn2 UTSW 15 34426169 missense probably benign 0.01
R8059:Matn2 UTSW 15 34345335 missense probably damaging 1.00
R8174:Matn2 UTSW 15 34422409 missense probably benign 0.30
R8331:Matn2 UTSW 15 34428681 missense probably damaging 1.00
R8354:Matn2 UTSW 15 34378697 missense probably damaging 0.98
R8377:Matn2 UTSW 15 34345365 missense probably damaging 1.00
R8393:Matn2 UTSW 15 34355602 missense possibly damaging 0.92
R8555:Matn2 UTSW 15 34423805 missense probably benign 0.03
R8756:Matn2 UTSW 15 34423730 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGACAATTAGCATGTTTGGGACC -3'
(R):5'- ATAGGCCCTTCAGACAGGTG -3'

Sequencing Primer
(F):5'- GCATGTTTGGGACCTGAAAAATC -3'
(R):5'- GGATACATCCGGACATGAC -3'
Posted On2021-01-18