Incidental Mutation 'R8532:Eif2b5'
ID659126
Institutional Source Beutler Lab
Gene Symbol Eif2b5
Ensembl Gene ENSMUSG00000003235
Gene Nameeukaryotic translation initiation factor 2B, subunit 5 epsilon
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R8532 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20498817-20509323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20505206 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 433 (V433A)
Ref Sequence ENSEMBL: ENSMUSP00000003320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003320] [ENSMUST00000148714]
Predicted Effect probably damaging
Transcript: ENSMUST00000003320
AA Change: V433A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: V433A

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:Hexapep 341 372 9.8e-5 PFAM
Pfam:Hexapep 361 389 6.1e-6 PFAM
low complexity region 517 526 N/A INTRINSIC
eIF5C 625 712 8.43e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148714
SMART Domains Protein: ENSMUSP00000121169
Gene: ENSMUSG00000003235

DomainStartEndE-ValueType
Pfam:W2 82 150 7e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231315
AA Change: V12A

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C A 2: 69,259,691 V950L possibly damaging Het
Acsl6 T A 11: 54,327,175 V238E probably damaging Het
Adam2 C A 14: 66,056,521 A286S probably damaging Het
Ankrd17 A T 5: 90,264,820 I1215N probably damaging Het
Anxa2 T C 9: 69,467,312 Y24H probably benign Het
Brms1l T C 12: 55,844,479 L106P probably damaging Het
Cacna1e A T 1: 154,465,764 L1166Q probably damaging Het
Ccdc110 T C 8: 45,942,995 L641P probably damaging Het
Cep78 T A 19: 15,959,584 D586V possibly damaging Het
Chek1 T C 9: 36,719,692 D142G probably benign Het
Dennd1b A G 1: 139,170,174 probably benign Het
Enpep A T 3: 129,276,653 Y868* probably null Het
Fam149a T A 8: 45,348,954 T414S possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm3604 A T 13: 62,368,955 C530S possibly damaging Het
Gtf2e2 T C 8: 33,758,605 F140S probably damaging Het
Ighv1-63 T C 12: 115,495,650 D109G probably damaging Het
Igkv3-9 G C 6: 70,588,722 V102L possibly damaging Het
Kif12 G A 4: 63,169,419 Q276* probably null Het
Lrba C T 3: 86,757,483 R557C probably damaging Het
Matn2 C A 15: 34,316,553 Q14K probably benign Het
Mical2 C A 7: 112,318,544 F369L probably damaging Het
Olfr1158 A G 2: 87,990,569 T153A probably damaging Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr675 T C 7: 105,024,566 Y138C probably damaging Het
Pramel1 A G 4: 143,398,555 T350A probably benign Het
Rcbtb1 T A 14: 59,210,524 C72* probably null Het
Ros1 T G 10: 52,098,756 T1578P possibly damaging Het
Rps6kb2 A T 19: 4,159,244 I200N probably damaging Het
Slc17a4 C A 13: 23,904,735 W223L probably damaging Het
Slitrk5 A T 14: 111,679,477 M178L probably benign Het
Snrpa A G 7: 27,191,602 probably null Het
Syt10 C T 15: 89,792,686 E366K probably damaging Het
Tbc1d16 A G 11: 119,155,167 F484L probably benign Het
Tbc1d30 A T 10: 121,267,430 W566R probably damaging Het
Tcaf1 A T 6: 42,678,131 I551K probably damaging Het
Tdrd7 A G 4: 46,016,920 T654A probably damaging Het
Timm44 A T 8: 4,260,549 I401N possibly damaging Het
Xcl1 T A 1: 164,931,946 T62S probably damaging Het
Zbtb11 A T 16: 55,990,889 H470L probably benign Het
Zfp57 A G 17: 37,009,901 T213A possibly damaging Het
Zfp715 A C 7: 43,299,405 I377S possibly damaging Het
Zfp715 A T 7: 43,299,710 D275E probably benign Het
Other mutations in Eif2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Eif2b5 APN 16 20505252 missense probably benign 0.19
IGL01073:Eif2b5 APN 16 20500296 nonsense probably null
IGL01467:Eif2b5 APN 16 20508964 nonsense probably null
IGL02754:Eif2b5 APN 16 20502786 missense possibly damaging 0.50
IGL03286:Eif2b5 APN 16 20502262 missense probably damaging 1.00
R0569:Eif2b5 UTSW 16 20502553 missense probably benign 0.13
R1321:Eif2b5 UTSW 16 20504689 nonsense probably null
R1647:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1648:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1897:Eif2b5 UTSW 16 20507037 missense probably damaging 0.99
R2231:Eif2b5 UTSW 16 20504770 missense probably benign
R3196:Eif2b5 UTSW 16 20505522 missense probably benign
R4423:Eif2b5 UTSW 16 20501719 missense probably benign 0.10
R4776:Eif2b5 UTSW 16 20500233 missense probably damaging 1.00
R5240:Eif2b5 UTSW 16 20501398 missense possibly damaging 0.49
R5828:Eif2b5 UTSW 16 20502786 missense possibly damaging 0.50
R5920:Eif2b5 UTSW 16 20498944 missense unknown
R5925:Eif2b5 UTSW 16 20508124 missense probably benign 0.02
R6717:Eif2b5 UTSW 16 20505283 missense probably damaging 0.96
R6915:Eif2b5 UTSW 16 20502750 missense possibly damaging 0.83
R7396:Eif2b5 UTSW 16 20506137 missense possibly damaging 0.69
R8046:Eif2b5 UTSW 16 20506404 missense possibly damaging 0.88
R8196:Eif2b5 UTSW 16 20502556 missense probably damaging 0.99
R8503:Eif2b5 UTSW 16 20498980 missense probably benign 0.23
Z1187:Eif2b5 UTSW 16 20498921 missense unknown
Z1192:Eif2b5 UTSW 16 20498921 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGATTGTCAAGACACAGTTCTC -3'
(R):5'- AAGGGAACATGCTTGTCTATGG -3'

Sequencing Primer
(F):5'- TGTCAAGACACAGTTCTCAGCCG -3'
(R):5'- ACAGACAGACAGACGCACAGATG -3'
Posted On2021-01-18