Incidental Mutation 'R8534:Per2'
ID659132
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Nameperiod circadian clock 2
SynonymsmPer2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R8534 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location91415982-91459324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91423937 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 949 (T949M)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
Predicted Effect probably benign
Transcript: ENSMUST00000069620
AA Change: T949M

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: T949M

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,540,342 L100R probably damaging Het
4930430A15Rik G A 2: 111,228,035 P138S possibly damaging Het
6820408C15Rik A G 2: 152,441,262 D282G probably damaging Het
Abcb11 G T 2: 69,323,846 N125K possibly damaging Het
Acbd7 A T 2: 3,340,713 D71V probably damaging Het
Adgrb1 A T 15: 74,543,508 T646S probably damaging Het
Adgrv1 A G 13: 81,386,768 Y5793H probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Ahrr A G 13: 74,220,680 S125P probably damaging Het
B020011L13Rik C A 1: 117,801,304 H180Q probably benign Het
Cbfa2t3 T C 8: 122,638,914 D219G probably damaging Het
Ccdc187 A G 2: 26,275,565 S860P possibly damaging Het
Ceacam5 A T 7: 17,750,746 Q471L probably benign Het
Cyp2c54 A C 19: 40,047,586 D293E probably damaging Het
Dnah1 G T 14: 31,301,848 N962K probably benign Het
Dst C T 1: 34,190,307 T2002I probably benign Het
Elavl1 A T 8: 4,289,864 N239K probably benign Het
Elmod3 A G 6: 72,566,684 F375L probably benign Het
G6pc2 T A 2: 69,220,125 N31K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm6569 G T 15: 73,839,824 probably benign Het
Insig1 C T 5: 28,075,118 S236L probably damaging Het
Itih4 A T 14: 30,901,022 N882I probably benign Het
Kmt5a C A 5: 124,460,572 D309E probably benign Het
Kndc1 C A 7: 139,923,753 T991N probably benign Het
Lingo1 T A 9: 56,621,069 T79S probably benign Het
Myh4 A T 11: 67,243,509 E330V probably benign Het
Nlrx1 A G 9: 44,262,773 V377A probably benign Het
Npy5r C A 8: 66,682,036 G35V probably benign Het
Olfr1454 T A 19: 13,064,068 I219N probably damaging Het
Olfr853 C T 9: 19,537,309 G207D possibly damaging Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Pcf11 A G 7: 92,653,224 V1226A probably benign Het
Phc1 G A 6: 122,338,580 probably benign Het
Pias2 A G 18: 77,097,387 I55V possibly damaging Het
Pik3r2 A T 8: 70,774,668 S104T probably benign Het
Pip T C 6: 41,851,487 V85A probably benign Het
Pms2 T C 5: 143,923,627 V86A probably benign Het
Rab44 A G 17: 29,144,573 probably null Het
Rrbp1 A G 2: 143,988,175 S691P probably damaging Het
Ruvbl2 A T 7: 45,429,694 probably null Het
Setbp1 T C 18: 78,783,327 D1357G possibly damaging Het
Slc12a6 T A 2: 112,343,967 I476N probably damaging Het
Slc1a1 C T 19: 28,905,346 P337S probably damaging Het
Slc35b3 T A 13: 38,944,590 T174S probably benign Het
Slc4a4 A T 5: 89,135,722 I467F probably damaging Het
Slc50a1 G A 3: 89,270,403 probably null Het
Spink14 G A 18: 44,031,012 probably null Het
Thegl T A 5: 77,059,478 I361N probably damaging Het
Tmem59 T C 4: 107,185,885 probably null Het
Tnr G A 1: 159,919,015 E1235K probably benign Het
Trpm6 A T 19: 18,892,095 R2015S probably benign Het
Tsnaxip1 A G 8: 105,838,738 E132G probably damaging Het
Vps54 A G 11: 21,277,706 N93S probably benign Het
Wdr17 T G 8: 54,648,230 I994L probably benign Het
Zfat G T 15: 68,165,847 H926Q probably damaging Het
Zfp2 C T 11: 50,900,800 E139K possibly damaging Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91448833 missense probably damaging 0.98
IGL01350:Per2 APN 1 91430861 missense probably damaging 1.00
IGL01865:Per2 APN 1 91421517 missense probably benign 0.10
IGL01974:Per2 APN 1 91423718 missense probably benign 0.02
IGL02118:Per2 APN 1 91424309 missense probably damaging 0.99
IGL02271:Per2 APN 1 91445610 missense probably damaging 1.00
IGL02533:Per2 APN 1 91431002 missense possibly damaging 0.92
IGL02707:Per2 APN 1 91450728 missense possibly damaging 0.94
IGL02972:Per2 APN 1 91423981 missense possibly damaging 0.50
IGL03118:Per2 APN 1 91444619 nonsense probably null
IGL03125:Per2 APN 1 91450611 missense probably benign 0.00
IGL03375:Per2 APN 1 91424228 missense possibly damaging 0.76
IGL03388:Per2 APN 1 91444789 splice site probably benign
Kortiku UTSW 1 91423829 missense probably damaging 1.00
obst UTSW 1 91445539 missense probably benign 0.00
rhythm UTSW 1 91429382 critical splice donor site probably null
ANU23:Per2 UTSW 1 91448833 missense probably damaging 0.98
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0542:Per2 UTSW 1 91438332 critical splice donor site probably null
R0764:Per2 UTSW 1 91429420 missense probably damaging 1.00
R1370:Per2 UTSW 1 91445557 missense possibly damaging 0.94
R1655:Per2 UTSW 1 91448768 missense probably damaging 1.00
R1688:Per2 UTSW 1 91423829 missense probably damaging 1.00
R1997:Per2 UTSW 1 91440859 missense probably damaging 1.00
R2891:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2893:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2894:Per2 UTSW 1 91445603 missense probably damaging 1.00
R3109:Per2 UTSW 1 91445575 missense probably benign 0.02
R4125:Per2 UTSW 1 91429450 missense possibly damaging 0.71
R4997:Per2 UTSW 1 91450783 missense probably benign 0.02
R5110:Per2 UTSW 1 91429515 missense possibly damaging 0.57
R5478:Per2 UTSW 1 91432868 missense probably benign 0.09
R5590:Per2 UTSW 1 91427856 nonsense probably null
R5634:Per2 UTSW 1 91444707 missense probably benign 0.02
R5654:Per2 UTSW 1 91445501 splice site probably null
R5928:Per2 UTSW 1 91444651 missense probably damaging 1.00
R6241:Per2 UTSW 1 91421529 missense probably damaging 0.97
R6295:Per2 UTSW 1 91449872 missense unknown
R6345:Per2 UTSW 1 91448722 missense probably damaging 1.00
R6480:Per2 UTSW 1 91429382 critical splice donor site probably null
R6502:Per2 UTSW 1 91427763 missense probably benign 0.01
R6702:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6703:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6790:Per2 UTSW 1 91445539 missense probably benign 0.00
R7043:Per2 UTSW 1 91419408 missense probably benign
R7092:Per2 UTSW 1 91421431 missense probably damaging 1.00
R7430:Per2 UTSW 1 91423983 nonsense probably null
R7555:Per2 UTSW 1 91435135 missense probably damaging 1.00
R7860:Per2 UTSW 1 91444759 missense probably damaging 0.99
R8046:Per2 UTSW 1 91435703 missense possibly damaging 0.56
R8142:Per2 UTSW 1 91421547 missense possibly damaging 0.90
R8261:Per2 UTSW 1 91433448 missense possibly damaging 0.87
R8277:Per2 UTSW 1 91420552 missense probably benign 0.15
R8685:Per2 UTSW 1 91450680 missense possibly damaging 0.88
X0011:Per2 UTSW 1 91420589 missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91421493 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGTGCAGTCCAGACCAGAAG -3'
(R):5'- AGCCTGAATTCGCAGTGCAG -3'

Sequencing Primer
(F):5'- TCCAGACCAGAAGCTGCTGTC -3'
(R):5'- AGCCCCTGCCATTCGCTG -3'
Posted On2021-01-18