Incidental Mutation 'R8534:Ccdc187'
ID 659137
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8534 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26275565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 860 (S860P)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect possibly damaging
Transcript: ENSMUST00000057224
AA Change: S860P

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: S860P

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: S860P
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: S899P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,540,342 L100R probably damaging Het
4930430A15Rik G A 2: 111,228,035 P138S possibly damaging Het
6820408C15Rik A G 2: 152,441,262 D282G probably damaging Het
Abcb11 G T 2: 69,323,846 N125K possibly damaging Het
Acbd7 A T 2: 3,340,713 D71V probably damaging Het
Adgrb1 A T 15: 74,543,508 T646S probably damaging Het
Adgrv1 A G 13: 81,386,768 Y5793H probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Ahrr A G 13: 74,220,680 S125P probably damaging Het
B020011L13Rik C A 1: 117,801,304 H180Q probably benign Het
Cbfa2t3 T C 8: 122,638,914 D219G probably damaging Het
Ceacam5 A T 7: 17,750,746 Q471L probably benign Het
Cyp2c54 A C 19: 40,047,586 D293E probably damaging Het
Dnah1 G T 14: 31,301,848 N962K probably benign Het
Dst C T 1: 34,190,307 T2002I probably benign Het
Elavl1 A T 8: 4,289,864 N239K probably benign Het
Elmod3 A G 6: 72,566,684 F375L probably benign Het
G6pc2 T A 2: 69,220,125 N31K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm6569 G T 15: 73,839,824 probably benign Het
Insig1 C T 5: 28,075,118 S236L probably damaging Het
Itih4 A T 14: 30,901,022 N882I probably benign Het
Kmt5a C A 5: 124,460,572 D309E probably benign Het
Kndc1 C A 7: 139,923,753 T991N probably benign Het
Lingo1 T A 9: 56,621,069 T79S probably benign Het
Myh4 A T 11: 67,243,509 E330V probably benign Het
Nlrx1 A G 9: 44,262,773 V377A probably benign Het
Npy5r C A 8: 66,682,036 G35V probably benign Het
Olfr1454 T A 19: 13,064,068 I219N probably damaging Het
Olfr853 C T 9: 19,537,309 G207D possibly damaging Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Pcf11 A G 7: 92,653,224 V1226A probably benign Het
Per2 G A 1: 91,423,937 T949M probably benign Het
Phc1 G A 6: 122,338,580 probably benign Het
Pias2 A G 18: 77,097,387 I55V possibly damaging Het
Pik3r2 A T 8: 70,774,668 S104T probably benign Het
Pip T C 6: 41,851,487 V85A probably benign Het
Pms2 T C 5: 143,923,627 V86A probably benign Het
Rab44 A G 17: 29,144,573 probably null Het
Rrbp1 A G 2: 143,988,175 S691P probably damaging Het
Ruvbl2 A T 7: 45,429,694 probably null Het
Setbp1 T C 18: 78,783,327 D1357G possibly damaging Het
Slc12a6 T A 2: 112,343,967 I476N probably damaging Het
Slc1a1 C T 19: 28,905,346 P337S probably damaging Het
Slc35b3 T A 13: 38,944,590 T174S probably benign Het
Slc4a4 A T 5: 89,135,722 I467F probably damaging Het
Slc50a1 G A 3: 89,270,403 probably null Het
Spink14 G A 18: 44,031,012 probably null Het
Thegl T A 5: 77,059,478 I361N probably damaging Het
Tmem59 T C 4: 107,185,885 probably null Het
Tnr G A 1: 159,919,015 E1235K probably benign Het
Trpm6 A T 19: 18,892,095 R2015S probably benign Het
Tsnaxip1 A G 8: 105,838,738 E132G probably damaging Het
Vps54 A G 11: 21,277,706 N93S probably benign Het
Wdr17 T G 8: 54,648,230 I994L probably benign Het
Zfat G T 15: 68,165,847 H926Q probably damaging Het
Zfp2 C T 11: 50,900,800 E139K possibly damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
R9454:Ccdc187 UTSW 2 26276102 missense possibly damaging 0.94
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCTGTGTCCTCTAGGCTAACAC -3'
(R):5'- TGGTGACAATAGCTGATGCTC -3'

Sequencing Primer
(F):5'- TGTGTCCTCTAGGCTAACACTAAGAC -3'
(R):5'- ACAGGCCATAGCTGTCTTG -3'
Posted On 2021-01-18