Incidental Mutation 'R8534:Cbfa2t3'
ID 659162
Institutional Source Beutler Lab
Gene Symbol Cbfa2t3
Ensembl Gene ENSMUSG00000006362
Gene Name core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human)
Synonyms MTGR2, ETO-2, Eto2, A630044F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8534 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 122625141-122699109 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122638914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000065728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006525] [ENSMUST00000064674] [ENSMUST00000127664] [ENSMUST00000127984] [ENSMUST00000134045]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006525
AA Change: D193G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006525
Gene: ENSMUSG00000006362
AA Change: D193G

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 87 177 5.46e-52 SMART
low complexity region 248 257 N/A INTRINSIC
Pfam:NHR2 295 361 3.6e-41 PFAM
PDB:2KYG|C 395 424 3e-10 PDB
Pfam:zf-MYND 472 508 2.6e-10 PFAM
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064674
AA Change: D219G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065728
Gene: ENSMUSG00000006362
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 113 203 5.46e-52 SMART
low complexity region 274 283 N/A INTRINSIC
Pfam:NHR2 321 387 7.1e-41 PFAM
PDB:2KYG|C 421 450 1e-10 PDB
Pfam:zf-MYND 498 534 7.1e-10 PFAM
low complexity region 555 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127984
AA Change: D254G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118997
Gene: ENSMUSG00000006362
AA Change: D254G

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
TAFH 148 238 5.46e-52 SMART
low complexity region 309 318 N/A INTRINSIC
Pfam:NHR2 356 422 2.3e-38 PFAM
PDB:2KYG|C 456 485 2e-10 PDB
Pfam:zf-MYND 533 569 6.9e-10 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134045
SMART Domains Protein: ENSMUSP00000117630
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:TAFH 111 185 3.7e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(16;21)(q24;q22) translocation is one of the less common karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. This gene is also a putative breast tumor suppressor. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice that are homozygote null for this gene display skewing of the early myeloid progenitor cells toward the granulocytic/macrophage lineage while reducing the numbers of megakaryocyte-erythroid progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,540,342 L100R probably damaging Het
4930430A15Rik G A 2: 111,228,035 P138S possibly damaging Het
6820408C15Rik A G 2: 152,441,262 D282G probably damaging Het
Abcb11 G T 2: 69,323,846 N125K possibly damaging Het
Acbd7 A T 2: 3,340,713 D71V probably damaging Het
Adgrb1 A T 15: 74,543,508 T646S probably damaging Het
Adgrv1 A G 13: 81,386,768 Y5793H probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Ahrr A G 13: 74,220,680 S125P probably damaging Het
B020011L13Rik C A 1: 117,801,304 H180Q probably benign Het
Ccdc187 A G 2: 26,275,565 S860P possibly damaging Het
Ceacam5 A T 7: 17,750,746 Q471L probably benign Het
Cyp2c54 A C 19: 40,047,586 D293E probably damaging Het
Dnah1 G T 14: 31,301,848 N962K probably benign Het
Dst C T 1: 34,190,307 T2002I probably benign Het
Elavl1 A T 8: 4,289,864 N239K probably benign Het
Elmod3 A G 6: 72,566,684 F375L probably benign Het
G6pc2 T A 2: 69,220,125 N31K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm6569 G T 15: 73,839,824 probably benign Het
Insig1 C T 5: 28,075,118 S236L probably damaging Het
Itih4 A T 14: 30,901,022 N882I probably benign Het
Kmt5a C A 5: 124,460,572 D309E probably benign Het
Kndc1 C A 7: 139,923,753 T991N probably benign Het
Lingo1 T A 9: 56,621,069 T79S probably benign Het
Myh4 A T 11: 67,243,509 E330V probably benign Het
Nlrx1 A G 9: 44,262,773 V377A probably benign Het
Npy5r C A 8: 66,682,036 G35V probably benign Het
Olfr1454 T A 19: 13,064,068 I219N probably damaging Het
Olfr853 C T 9: 19,537,309 G207D possibly damaging Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Pcf11 A G 7: 92,653,224 V1226A probably benign Het
Per2 G A 1: 91,423,937 T949M probably benign Het
Phc1 G A 6: 122,338,580 probably benign Het
Pias2 A G 18: 77,097,387 I55V possibly damaging Het
Pik3r2 A T 8: 70,774,668 S104T probably benign Het
Pip T C 6: 41,851,487 V85A probably benign Het
Pms2 T C 5: 143,923,627 V86A probably benign Het
Rab44 A G 17: 29,144,573 probably null Het
Rrbp1 A G 2: 143,988,175 S691P probably damaging Het
Ruvbl2 A T 7: 45,429,694 probably null Het
Setbp1 T C 18: 78,783,327 D1357G possibly damaging Het
Slc12a6 T A 2: 112,343,967 I476N probably damaging Het
Slc1a1 C T 19: 28,905,346 P337S probably damaging Het
Slc35b3 T A 13: 38,944,590 T174S probably benign Het
Slc4a4 A T 5: 89,135,722 I467F probably damaging Het
Slc50a1 G A 3: 89,270,403 probably null Het
Spink14 G A 18: 44,031,012 probably null Het
Thegl T A 5: 77,059,478 I361N probably damaging Het
Tmem59 T C 4: 107,185,885 probably null Het
Tnr G A 1: 159,919,015 E1235K probably benign Het
Trpm6 A T 19: 18,892,095 R2015S probably benign Het
Tsnaxip1 A G 8: 105,838,738 E132G probably damaging Het
Vps54 A G 11: 21,277,706 N93S probably benign Het
Wdr17 T G 8: 54,648,230 I994L probably benign Het
Zfat G T 15: 68,165,847 H926Q probably damaging Het
Zfp2 C T 11: 50,900,800 E139K possibly damaging Het
Other mutations in Cbfa2t3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Cbfa2t3 APN 8 122633493 missense probably damaging 1.00
IGL02578:Cbfa2t3 APN 8 122633448 missense possibly damaging 0.83
IGL02934:Cbfa2t3 APN 8 122647758 missense probably benign 0.03
IGL03089:Cbfa2t3 APN 8 122635134 missense probably damaging 1.00
R0196:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.77
R0365:Cbfa2t3 UTSW 8 122635060 missense probably benign 0.23
R0395:Cbfa2t3 UTSW 8 122638951 missense probably benign 0.09
R0784:Cbfa2t3 UTSW 8 122650487 splice site probably benign
R0835:Cbfa2t3 UTSW 8 122647778 missense probably benign 0.00
R1608:Cbfa2t3 UTSW 8 122647709 missense probably damaging 0.99
R2008:Cbfa2t3 UTSW 8 122643293 missense probably damaging 0.99
R2088:Cbfa2t3 UTSW 8 122637986 unclassified probably benign
R2095:Cbfa2t3 UTSW 8 122634988 missense probably benign
R4079:Cbfa2t3 UTSW 8 122647695 splice site probably null
R4175:Cbfa2t3 UTSW 8 122643318 missense probably damaging 1.00
R5013:Cbfa2t3 UTSW 8 122638859 missense possibly damaging 0.95
R5141:Cbfa2t3 UTSW 8 122635021 missense probably benign 0.24
R5391:Cbfa2t3 UTSW 8 122633395 nonsense probably null
R6067:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6078:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6192:Cbfa2t3 UTSW 8 122634396 missense probably benign 0.00
R6281:Cbfa2t3 UTSW 8 122633409 missense probably damaging 1.00
R6520:Cbfa2t3 UTSW 8 122635801 missense probably benign 0.02
R6936:Cbfa2t3 UTSW 8 122647739 missense probably damaging 0.97
R7154:Cbfa2t3 UTSW 8 122638144 nonsense probably null
R7196:Cbfa2t3 UTSW 8 122638990 missense probably benign 0.26
R7295:Cbfa2t3 UTSW 8 122638029 missense probably benign 0.02
R7514:Cbfa2t3 UTSW 8 122635126 missense probably damaging 1.00
R7616:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.87
R8070:Cbfa2t3 UTSW 8 122642981 missense possibly damaging 0.81
R8485:Cbfa2t3 UTSW 8 122630778 missense probably damaging 0.97
R9718:Cbfa2t3 UTSW 8 122638197 missense probably benign 0.25
U15987:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
Z1176:Cbfa2t3 UTSW 8 122698895 start gained probably benign
Z1177:Cbfa2t3 UTSW 8 122630757 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTGTAGAACCCAGTGTGG -3'
(R):5'- GAACAGGCTACGTGGGTTTG -3'

Sequencing Primer
(F):5'- TTAGCAGCGCTCGATCAG -3'
(R):5'- GTTTGCACCCCAGCTGTCAG -3'
Posted On 2021-01-18