Incidental Mutation 'R8534:Slc35b3'
ID 659171
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Name solute carrier family 35, member B3
Synonyms 4921526O06Rik, PAPST2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock # R8534 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 38932136-38960875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38944590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 174 (T174S)
Ref Sequence ENSEMBL: ENSMUSP00000021870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225331] [ENSMUST00000225396] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
AlphaFold Q922Q5
Predicted Effect probably benign
Transcript: ENSMUST00000021870
AA Change: T174S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: T174S

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167513
AA Change: T130S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: T130S

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
Predicted Effect probably benign
Transcript: ENSMUST00000225331
Predicted Effect probably benign
Transcript: ENSMUST00000225396
Predicted Effect probably benign
Transcript: ENSMUST00000225432
AA Change: T130S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000225461
Predicted Effect probably benign
Transcript: ENSMUST00000225568
AA Change: T32S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000225714
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,540,342 L100R probably damaging Het
4930430A15Rik G A 2: 111,228,035 P138S possibly damaging Het
6820408C15Rik A G 2: 152,441,262 D282G probably damaging Het
Abcb11 G T 2: 69,323,846 N125K possibly damaging Het
Acbd7 A T 2: 3,340,713 D71V probably damaging Het
Adgrb1 A T 15: 74,543,508 T646S probably damaging Het
Adgrv1 A G 13: 81,386,768 Y5793H probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Ahrr A G 13: 74,220,680 S125P probably damaging Het
B020011L13Rik C A 1: 117,801,304 H180Q probably benign Het
Cbfa2t3 T C 8: 122,638,914 D219G probably damaging Het
Ccdc187 A G 2: 26,275,565 S860P possibly damaging Het
Ceacam5 A T 7: 17,750,746 Q471L probably benign Het
Cyp2c54 A C 19: 40,047,586 D293E probably damaging Het
Dnah1 G T 14: 31,301,848 N962K probably benign Het
Dst C T 1: 34,190,307 T2002I probably benign Het
Elavl1 A T 8: 4,289,864 N239K probably benign Het
Elmod3 A G 6: 72,566,684 F375L probably benign Het
G6pc2 T A 2: 69,220,125 N31K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm6569 G T 15: 73,839,824 probably benign Het
Insig1 C T 5: 28,075,118 S236L probably damaging Het
Itih4 A T 14: 30,901,022 N882I probably benign Het
Kmt5a C A 5: 124,460,572 D309E probably benign Het
Kndc1 C A 7: 139,923,753 T991N probably benign Het
Lingo1 T A 9: 56,621,069 T79S probably benign Het
Myh4 A T 11: 67,243,509 E330V probably benign Het
Nlrx1 A G 9: 44,262,773 V377A probably benign Het
Npy5r C A 8: 66,682,036 G35V probably benign Het
Olfr1454 T A 19: 13,064,068 I219N probably damaging Het
Olfr853 C T 9: 19,537,309 G207D possibly damaging Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Pcf11 A G 7: 92,653,224 V1226A probably benign Het
Per2 G A 1: 91,423,937 T949M probably benign Het
Phc1 G A 6: 122,338,580 probably benign Het
Pias2 A G 18: 77,097,387 I55V possibly damaging Het
Pik3r2 A T 8: 70,774,668 S104T probably benign Het
Pip T C 6: 41,851,487 V85A probably benign Het
Pms2 T C 5: 143,923,627 V86A probably benign Het
Rab44 A G 17: 29,144,573 probably null Het
Rrbp1 A G 2: 143,988,175 S691P probably damaging Het
Ruvbl2 A T 7: 45,429,694 probably null Het
Setbp1 T C 18: 78,783,327 D1357G possibly damaging Het
Slc12a6 T A 2: 112,343,967 I476N probably damaging Het
Slc1a1 C T 19: 28,905,346 P337S probably damaging Het
Slc4a4 A T 5: 89,135,722 I467F probably damaging Het
Slc50a1 G A 3: 89,270,403 probably null Het
Spink14 G A 18: 44,031,012 probably null Het
Thegl T A 5: 77,059,478 I361N probably damaging Het
Tmem59 T C 4: 107,185,885 probably null Het
Tnr G A 1: 159,919,015 E1235K probably benign Het
Trpm6 A T 19: 18,892,095 R2015S probably benign Het
Tsnaxip1 A G 8: 105,838,738 E132G probably damaging Het
Vps54 A G 11: 21,277,706 N93S probably benign Het
Wdr17 T G 8: 54,648,230 I994L probably benign Het
Zfat G T 15: 68,165,847 H926Q probably damaging Het
Zfp2 C T 11: 50,900,800 E139K possibly damaging Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3874:Slc35b3 UTSW 13 38943068 missense possibly damaging 0.66
R3897:Slc35b3 UTSW 13 38934763 missense probably benign 0.09
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6155:Slc35b3 UTSW 13 38944596 missense probably damaging 1.00
R6663:Slc35b3 UTSW 13 38954136 missense probably damaging 0.99
R7701:Slc35b3 UTSW 13 38944635 missense probably benign 0.03
R8796:Slc35b3 UTSW 13 38937746 critical splice donor site probably benign
R8950:Slc35b3 UTSW 13 38954121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCAGTTGTGGACATTTGATTG -3'
(R):5'- CCGATAAGCAGTGTTACAACTTG -3'

Sequencing Primer
(F):5'- GATTGTTTTTCCTAATGCCAGATGC -3'
(R):5'- TGACATTTTAAACGTATGCTTCCAG -3'
Posted On 2021-01-18