Incidental Mutation 'R8534:Adgrv1'
ID 659173
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Name adhesion G protein-coupled receptor V1
Synonyms Mass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 068503-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8534 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 81243187-81781273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81534887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 5793 (Y5793H)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000095585
AA Change: Y5793H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: Y5793H

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125698
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,545,153 (GRCm39) L100R probably damaging Het
6820408C15Rik A G 2: 152,283,182 (GRCm39) D282G probably damaging Het
Abcb11 G T 2: 69,154,190 (GRCm39) N125K possibly damaging Het
Acbd7 A T 2: 3,341,750 (GRCm39) D71V probably damaging Het
Adgrb1 A T 15: 74,415,357 (GRCm39) T646S probably damaging Het
Agmo A G 12: 37,302,538 (GRCm39) D125G probably damaging Het
Ahrr A G 13: 74,368,799 (GRCm39) S125P probably damaging Het
B020011L13Rik C A 1: 117,729,034 (GRCm39) H180Q probably benign Het
Cbfa2t3 T C 8: 123,365,653 (GRCm39) D219G probably damaging Het
Ccdc187 A G 2: 26,165,577 (GRCm39) S860P possibly damaging Het
Ceacam5 A T 7: 17,484,671 (GRCm39) Q471L probably benign Het
Cyp2c54 A C 19: 40,036,030 (GRCm39) D293E probably damaging Het
Dnah1 G T 14: 31,023,805 (GRCm39) N962K probably benign Het
Dst C T 1: 34,229,388 (GRCm39) T2002I probably benign Het
Elavl1 A T 8: 4,339,864 (GRCm39) N239K probably benign Het
Elmod3 A G 6: 72,543,667 (GRCm39) F375L probably benign Het
G6pc2 T A 2: 69,050,469 (GRCm39) N31K probably benign Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm6569 G T 15: 73,711,673 (GRCm39) probably benign Het
Insig1 C T 5: 28,280,116 (GRCm39) S236L probably damaging Het
Itih4 A T 14: 30,622,979 (GRCm39) N882I probably benign Het
Kmt5a C A 5: 124,598,635 (GRCm39) D309E probably benign Het
Kndc1 C A 7: 139,503,669 (GRCm39) T991N probably benign Het
Lingo1 T A 9: 56,528,353 (GRCm39) T79S probably benign Het
Myh4 A T 11: 67,134,335 (GRCm39) E330V probably benign Het
Nlrx1 A G 9: 44,174,070 (GRCm39) V377A probably benign Het
Npy5r C A 8: 67,134,688 (GRCm39) G35V probably benign Het
Or5b102 T A 19: 13,041,432 (GRCm39) I219N probably damaging Het
Or7g33 C T 9: 19,448,605 (GRCm39) G207D possibly damaging Het
Pabpn1l T C 8: 123,349,358 (GRCm39) T20A probably benign Het
Pcf11 A G 7: 92,302,432 (GRCm39) V1226A probably benign Het
Per2 G A 1: 91,351,659 (GRCm39) T949M probably benign Het
Phc1 G A 6: 122,315,539 (GRCm39) probably benign Het
Pias2 A G 18: 77,185,083 (GRCm39) I55V possibly damaging Het
Pik3r2 A T 8: 71,227,312 (GRCm39) S104T probably benign Het
Pip T C 6: 41,828,421 (GRCm39) V85A probably benign Het
Pms2 T C 5: 143,860,445 (GRCm39) V86A probably benign Het
Potefam1 G A 2: 111,058,380 (GRCm39) P138S possibly damaging Het
Rab44 A G 17: 29,363,547 (GRCm39) probably null Het
Rrbp1 A G 2: 143,830,095 (GRCm39) S691P probably damaging Het
Ruvbl2 A T 7: 45,079,118 (GRCm39) probably null Het
Setbp1 T C 18: 78,826,542 (GRCm39) D1357G possibly damaging Het
Slc12a6 T A 2: 112,174,312 (GRCm39) I476N probably damaging Het
Slc1a1 C T 19: 28,882,746 (GRCm39) P337S probably damaging Het
Slc35b3 T A 13: 39,128,566 (GRCm39) T174S probably benign Het
Slc4a4 A T 5: 89,283,581 (GRCm39) I467F probably damaging Het
Slc50a1 G A 3: 89,177,710 (GRCm39) probably null Het
Spink14 G A 18: 44,164,079 (GRCm39) probably null Het
Spmap2l T A 5: 77,207,325 (GRCm39) I361N probably damaging Het
Tmem59 T C 4: 107,043,082 (GRCm39) probably null Het
Tnr G A 1: 159,746,585 (GRCm39) E1235K probably benign Het
Trpm6 A T 19: 18,869,459 (GRCm39) R2015S probably benign Het
Tsnaxip1 A G 8: 106,565,370 (GRCm39) E132G probably damaging Het
Vps54 A G 11: 21,227,706 (GRCm39) N93S probably benign Het
Wdr17 T G 8: 55,101,265 (GRCm39) I994L probably benign Het
Zfat G T 15: 68,037,696 (GRCm39) H926Q probably damaging Het
Zfp2 C T 11: 50,791,627 (GRCm39) E139K possibly damaging Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81,553,527 (GRCm39) critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81,620,996 (GRCm39) splice site probably benign
IGL00471:Adgrv1 APN 13 81,657,661 (GRCm39) missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81,637,193 (GRCm39) missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81,654,306 (GRCm39) missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81,672,803 (GRCm39) missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81,726,349 (GRCm39) missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81,545,322 (GRCm39) missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81,688,238 (GRCm39) missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81,530,410 (GRCm39) missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81,637,147 (GRCm39) missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81,567,470 (GRCm39) missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81,553,518 (GRCm39) missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81,567,247 (GRCm39) missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81,705,184 (GRCm39) missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81,705,277 (GRCm39) missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81,614,303 (GRCm39) missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81,567,750 (GRCm39) missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81,715,461 (GRCm39) missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81,677,168 (GRCm39) missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81,620,513 (GRCm39) critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81,330,902 (GRCm39) missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81,594,549 (GRCm39) missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81,705,428 (GRCm39) missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81,705,115 (GRCm39) missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81,716,862 (GRCm39) splice site probably benign
IGL02016:Adgrv1 APN 13 81,545,572 (GRCm39) missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81,727,909 (GRCm39) missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81,575,783 (GRCm39) missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81,707,314 (GRCm39) splice site probably null
IGL02328:Adgrv1 APN 13 81,726,294 (GRCm39) missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81,607,832 (GRCm39) missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81,707,543 (GRCm39) missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81,627,789 (GRCm39) missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81,583,675 (GRCm39) splice site probably benign
IGL02603:Adgrv1 APN 13 81,637,071 (GRCm39) missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81,659,738 (GRCm39) missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81,726,991 (GRCm39) missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81,711,851 (GRCm39) missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81,668,858 (GRCm39) missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81,727,833 (GRCm39) missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81,581,755 (GRCm39) missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81,671,731 (GRCm39) missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81,726,973 (GRCm39) missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81,590,599 (GRCm39) missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81,621,018 (GRCm39) missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81,707,648 (GRCm39) missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81,581,819 (GRCm39) missense probably benign 0.02
IGL03119:Adgrv1 APN 13 81,530,492 (GRCm39) missense probably damaging 1.00
IGL03169:Adgrv1 APN 13 81,652,019 (GRCm39) missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81,581,737 (GRCm39) missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81,594,597 (GRCm39) missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81,255,017 (GRCm39) splice site probably null
IGL03343:Adgrv1 APN 13 81,431,507 (GRCm39) missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81,647,177 (GRCm39) missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81,629,455 (GRCm39) missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81,711,751 (GRCm39) missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81,666,086 (GRCm39) missense probably damaging 0.99
abetting UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
beatle UTSW 13 81,727,713 (GRCm39) nonsense probably null
Escape UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
lento UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
Metronome UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
Murderous UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
Nome UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
Propulsion UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
revulsion UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
Saturnv UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
Thrust UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
Velocity UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
Wilting UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
Withering UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81,568,125 (GRCm39) missense probably benign 0.13
G1patch:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
G1patch:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
I2288:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81,677,104 (GRCm39) missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81,707,471 (GRCm39) missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0087:Adgrv1 UTSW 13 81,535,070 (GRCm39) missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0131:Adgrv1 UTSW 13 81,651,114 (GRCm39) unclassified probably benign
R0218:Adgrv1 UTSW 13 81,255,017 (GRCm39) splice site probably null
R0325:Adgrv1 UTSW 13 81,688,134 (GRCm39) missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81,623,112 (GRCm39) missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81,534,072 (GRCm39) missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81,545,345 (GRCm39) nonsense probably null
R0466:Adgrv1 UTSW 13 81,714,415 (GRCm39) missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81,637,154 (GRCm39) missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81,707,269 (GRCm39) missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81,676,561 (GRCm39) splice site probably benign
R0532:Adgrv1 UTSW 13 81,727,015 (GRCm39) missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81,721,437 (GRCm39) missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81,676,649 (GRCm39) missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81,623,224 (GRCm39) missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81,651,123 (GRCm39) missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81,718,675 (GRCm39) missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81,647,244 (GRCm39) missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81,627,861 (GRCm39) nonsense probably null
R0962:Adgrv1 UTSW 13 81,553,465 (GRCm39) missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81,705,182 (GRCm39) missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81,588,156 (GRCm39) splice site probably benign
R1310:Adgrv1 UTSW 13 81,714,496 (GRCm39) missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81,676,984 (GRCm39) missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81,641,295 (GRCm39) missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81,534,907 (GRCm39) missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81,243,569 (GRCm39) missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81,581,632 (GRCm39) missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81,727,738 (GRCm39) missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81,620,699 (GRCm39) critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81,705,076 (GRCm39) missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81,741,167 (GRCm39) missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81,652,097 (GRCm39) splice site probably null
R1579:Adgrv1 UTSW 13 81,711,898 (GRCm39) missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81,614,279 (GRCm39) critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81,707,236 (GRCm39) missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81,572,407 (GRCm39) missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81,635,972 (GRCm39) missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81,624,750 (GRCm39) missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81,707,671 (GRCm39) missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81,741,179 (GRCm39) missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81,636,066 (GRCm39) missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81,654,265 (GRCm39) missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81,637,196 (GRCm39) missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81,652,232 (GRCm39) missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81,692,652 (GRCm39) missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81,711,685 (GRCm39) missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81,740,670 (GRCm39) splice site probably benign
R1928:Adgrv1 UTSW 13 81,668,905 (GRCm39) missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81,539,876 (GRCm39) missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81,659,030 (GRCm39) missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81,671,868 (GRCm39) missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81,709,588 (GRCm39) missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81,677,132 (GRCm39) missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81,640,656 (GRCm39) missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81,568,069 (GRCm39) missense probably benign 0.02
R2125:Adgrv1 UTSW 13 81,567,654 (GRCm39) missense probably benign 0.00
R2127:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81,729,846 (GRCm39) missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81,672,676 (GRCm39) critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81,593,439 (GRCm39) missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81,714,409 (GRCm39) missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81,654,259 (GRCm39) missense probably benign
R2260:Adgrv1 UTSW 13 81,716,493 (GRCm39) missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81,743,298 (GRCm39) missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R2910:Adgrv1 UTSW 13 81,705,238 (GRCm39) missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81,596,984 (GRCm39) missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81,729,866 (GRCm39) missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81,691,661 (GRCm39) missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81,672,719 (GRCm39) missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81,567,594 (GRCm39) missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81,647,162 (GRCm39) missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81,741,221 (GRCm39) missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81,431,486 (GRCm39) start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81,588,191 (GRCm39) missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81,726,891 (GRCm39) missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81,330,908 (GRCm39) missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4003:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4194:Adgrv1 UTSW 13 81,647,115 (GRCm39) missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81,588,311 (GRCm39) missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81,641,029 (GRCm39) missense unknown
R4388:Adgrv1 UTSW 13 81,729,828 (GRCm39) missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81,714,421 (GRCm39) missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81,567,349 (GRCm39) missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81,588,185 (GRCm39) missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81,567,927 (GRCm39) missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81,642,688 (GRCm39) splice site probably null
R4647:Adgrv1 UTSW 13 81,676,914 (GRCm39) nonsense probably null
R4657:Adgrv1 UTSW 13 81,553,483 (GRCm39) missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81,581,644 (GRCm39) missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81,255,038 (GRCm39) missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81,243,564 (GRCm39) missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81,303,350 (GRCm39) nonsense probably null
R4816:Adgrv1 UTSW 13 81,676,793 (GRCm39) missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81,708,963 (GRCm39) missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81,651,120 (GRCm39) critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81,681,241 (GRCm39) intron probably benign
R4897:Adgrv1 UTSW 13 81,709,704 (GRCm39) splice site probably null
R4906:Adgrv1 UTSW 13 81,418,857 (GRCm39) splice site probably null
R4917:Adgrv1 UTSW 13 81,658,996 (GRCm39) missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81,726,853 (GRCm39) missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81,607,948 (GRCm39) missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81,637,050 (GRCm39) missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81,676,940 (GRCm39) missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81,740,704 (GRCm39) missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81,243,606 (GRCm39) missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81,567,546 (GRCm39) missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81,587,560 (GRCm39) missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81,583,793 (GRCm39) missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81,431,535 (GRCm39) start gained probably benign
R5203:Adgrv1 UTSW 13 81,659,024 (GRCm39) missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81,637,048 (GRCm39) nonsense probably null
R5280:Adgrv1 UTSW 13 81,545,584 (GRCm39) missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81,669,203 (GRCm39) missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81,726,372 (GRCm39) missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81,624,809 (GRCm39) missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81,677,165 (GRCm39) missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81,607,834 (GRCm39) missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81,567,427 (GRCm39) missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81,572,377 (GRCm39) missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81,593,363 (GRCm39) missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81,567,508 (GRCm39) missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81,581,808 (GRCm39) missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81,624,683 (GRCm39) missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81,553,386 (GRCm39) missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81,303,395 (GRCm39) missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81,669,236 (GRCm39) missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81,620,619 (GRCm39) missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81,670,355 (GRCm39) missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81,251,421 (GRCm39) missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81,572,390 (GRCm39) missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81,545,570 (GRCm39) missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81,255,194 (GRCm39) missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81,534,985 (GRCm39) missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81,590,620 (GRCm39) missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81,614,378 (GRCm39) missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81,545,542 (GRCm39) nonsense probably null
R6024:Adgrv1 UTSW 13 81,624,624 (GRCm39) missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81,539,814 (GRCm39) missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81,575,864 (GRCm39) missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81,654,195 (GRCm39) missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81,330,893 (GRCm39) missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81,567,378 (GRCm39) missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81,534,124 (GRCm39) missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81,581,957 (GRCm39) missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81,672,898 (GRCm39) splice site probably null
R6190:Adgrv1 UTSW 13 81,607,882 (GRCm39) splice site probably null
R6215:Adgrv1 UTSW 13 81,727,713 (GRCm39) nonsense probably null
R6216:Adgrv1 UTSW 13 81,672,590 (GRCm39) splice site probably null
R6238:Adgrv1 UTSW 13 81,614,402 (GRCm39) missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81,255,050 (GRCm39) missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81,647,187 (GRCm39) missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81,534,100 (GRCm39) missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81,562,702 (GRCm39) missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81,656,855 (GRCm39) missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81,723,220 (GRCm39) splice site probably null
R6467:Adgrv1 UTSW 13 81,592,657 (GRCm39) missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81,707,609 (GRCm39) missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81,715,462 (GRCm39) missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81,581,771 (GRCm39) missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81,654,298 (GRCm39) missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81,636,081 (GRCm39) missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81,629,634 (GRCm39) missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81,620,597 (GRCm39) missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81,621,072 (GRCm39) missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81,705,200 (GRCm39) missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81,303,273 (GRCm39) critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81,581,613 (GRCm39) missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81,676,820 (GRCm39) missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81,656,788 (GRCm39) missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81,715,609 (GRCm39) missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81,669,116 (GRCm39) missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81,670,223 (GRCm39) critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81,709,593 (GRCm39) missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81,726,261 (GRCm39) missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81,545,328 (GRCm39) missense possibly damaging 0.52
R7205:Adgrv1 UTSW 13 81,627,777 (GRCm39) missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81,624,731 (GRCm39) missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81,522,378 (GRCm39) missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81,668,634 (GRCm39) missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81,708,808 (GRCm39) missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81,707,467 (GRCm39) missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81,711,738 (GRCm39) missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81,647,192 (GRCm39) missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81,727,596 (GRCm39) missense probably damaging 1.00
R7567:Adgrv1 UTSW 13 81,581,648 (GRCm39) missense probably benign 0.00
R7614:Adgrv1 UTSW 13 81,668,780 (GRCm39) missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81,570,344 (GRCm39) missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81,647,261 (GRCm39) missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81,721,433 (GRCm39) missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81,676,760 (GRCm39) missense possibly damaging 0.81
R7854:Adgrv1 UTSW 13 81,741,207 (GRCm39) missense probably damaging 1.00
R7894:Adgrv1 UTSW 13 81,715,570 (GRCm39) missense probably benign 0.00
R7948:Adgrv1 UTSW 13 81,707,707 (GRCm39) missense probably damaging 1.00
R7948:Adgrv1 UTSW 13 81,707,648 (GRCm39) missense probably damaging 1.00
R7949:Adgrv1 UTSW 13 81,303,353 (GRCm39) missense probably damaging 1.00
R7951:Adgrv1 UTSW 13 81,711,689 (GRCm39) missense probably damaging 1.00
R7968:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7969:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7973:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8007:Adgrv1 UTSW 13 81,431,585 (GRCm39) missense probably benign 0.04
R8018:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8044:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8050:Adgrv1 UTSW 13 81,561,296 (GRCm39) missense probably damaging 1.00
R8090:Adgrv1 UTSW 13 81,596,953 (GRCm39) critical splice donor site probably null
R8104:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8122:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R8122:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8123:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8125:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8126:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8212:Adgrv1 UTSW 13 81,670,240 (GRCm39) missense probably benign 0.01
R8221:Adgrv1 UTSW 13 81,677,033 (GRCm39) missense probably benign 0.00
R8256:Adgrv1 UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
R8270:Adgrv1 UTSW 13 81,651,163 (GRCm39) missense probably damaging 0.96
R8290:Adgrv1 UTSW 13 81,630,002 (GRCm39) missense probably benign 0.00
R8298:Adgrv1 UTSW 13 81,534,033 (GRCm39) nonsense probably null
R8317:Adgrv1 UTSW 13 81,723,236 (GRCm39) missense probably damaging 0.98
R8326:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8327:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8330:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8332:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8345:Adgrv1 UTSW 13 81,251,505 (GRCm39) missense probably damaging 1.00
R8398:Adgrv1 UTSW 13 81,330,797 (GRCm39) missense probably damaging 1.00
R8399:Adgrv1 UTSW 13 81,637,289 (GRCm39) missense possibly damaging 0.55
R8450:Adgrv1 UTSW 13 81,583,962 (GRCm39) splice site probably null
R8471:Adgrv1 UTSW 13 81,594,591 (GRCm39) missense probably benign 0.00
R8537:Adgrv1 UTSW 13 81,684,491 (GRCm39) missense probably damaging 1.00
R8703:Adgrv1 UTSW 13 81,676,792 (GRCm39) missense probably damaging 1.00
R8845:Adgrv1 UTSW 13 81,629,478 (GRCm39) missense possibly damaging 0.79
R8846:Adgrv1 UTSW 13 81,637,025 (GRCm39) critical splice donor site probably null
R8849:Adgrv1 UTSW 13 81,669,324 (GRCm39) missense probably benign
R8856:Adgrv1 UTSW 13 81,707,621 (GRCm39) missense probably benign 0.11
R8915:Adgrv1 UTSW 13 81,715,558 (GRCm39) missense probably damaging 1.00
R8963:Adgrv1 UTSW 13 81,567,588 (GRCm39) missense probably benign
R8994:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8995:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8996:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8997:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R9022:Adgrv1 UTSW 13 81,303,312 (GRCm39) missense probably damaging 1.00
R9059:Adgrv1 UTSW 13 81,562,692 (GRCm39) critical splice donor site probably null
R9076:Adgrv1 UTSW 13 81,570,247 (GRCm39) critical splice donor site probably null
R9119:Adgrv1 UTSW 13 81,658,995 (GRCm39) missense probably damaging 0.97
R9137:Adgrv1 UTSW 13 81,688,133 (GRCm39) missense probably damaging 1.00
R9146:Adgrv1 UTSW 13 81,561,291 (GRCm39) missense probably benign 0.11
R9156:Adgrv1 UTSW 13 81,669,302 (GRCm39) missense probably benign 0.00
R9163:Adgrv1 UTSW 13 81,567,541 (GRCm39) missense probably benign 0.19
R9282:Adgrv1 UTSW 13 81,251,491 (GRCm39) missense probably damaging 1.00
R9286:Adgrv1 UTSW 13 81,594,520 (GRCm39) missense probably damaging 0.98
R9328:Adgrv1 UTSW 13 81,620,523 (GRCm39) missense probably damaging 1.00
R9329:Adgrv1 UTSW 13 81,647,241 (GRCm39) missense probably damaging 1.00
R9350:Adgrv1 UTSW 13 81,654,274 (GRCm39) missense probably damaging 1.00
R9377:Adgrv1 UTSW 13 81,705,277 (GRCm39) missense probably damaging 0.99
R9394:Adgrv1 UTSW 13 81,624,767 (GRCm39) missense possibly damaging 0.95
R9419:Adgrv1 UTSW 13 81,656,887 (GRCm39) missense probably benign 0.44
R9427:Adgrv1 UTSW 13 81,732,234 (GRCm39) missense probably benign 0.00
R9429:Adgrv1 UTSW 13 81,741,165 (GRCm39) missense probably damaging 0.99
R9429:Adgrv1 UTSW 13 81,567,468 (GRCm39) missense probably damaging 1.00
R9433:Adgrv1 UTSW 13 81,714,471 (GRCm39) missense probably benign 0.02
R9434:Adgrv1 UTSW 13 81,666,292 (GRCm39) splice site probably benign
R9513:Adgrv1 UTSW 13 81,530,472 (GRCm39) missense possibly damaging 0.95
R9515:Adgrv1 UTSW 13 81,691,497 (GRCm39) missense probably damaging 0.99
R9523:Adgrv1 UTSW 13 81,567,178 (GRCm39) missense
R9525:Adgrv1 UTSW 13 81,593,453 (GRCm39) missense possibly damaging 0.77
R9576:Adgrv1 UTSW 13 81,691,608 (GRCm39) missense probably benign 0.06
R9612:Adgrv1 UTSW 13 81,641,082 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,743,371 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,670,288 (GRCm39) missense probably benign 0.01
R9702:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R9717:Adgrv1 UTSW 13 81,668,900 (GRCm39) missense probably damaging 1.00
R9720:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81,707,389 (GRCm39) missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81,535,045 (GRCm39) missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81,691,511 (GRCm39) missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81,624,791 (GRCm39) missense probably damaging 1.00
Z1176:Adgrv1 UTSW 13 81,707,753 (GRCm39) missense possibly damaging 0.90
Z1177:Adgrv1 UTSW 13 81,567,375 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AACTTTTCCACCTACATTTGAAGCC -3'
(R):5'- TGACAGTTGCCCATATCTGTC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- AGTTGCCCATATCTGTCAATTCTGG -3'
Posted On 2021-01-18