Incidental Mutation 'R8534:Trpm6'
ID 659183
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 068503-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8534 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18869459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 2015 (R2015S)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: R2015S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: R2015S

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,545,153 (GRCm39) L100R probably damaging Het
6820408C15Rik A G 2: 152,283,182 (GRCm39) D282G probably damaging Het
Abcb11 G T 2: 69,154,190 (GRCm39) N125K possibly damaging Het
Acbd7 A T 2: 3,341,750 (GRCm39) D71V probably damaging Het
Adgrb1 A T 15: 74,415,357 (GRCm39) T646S probably damaging Het
Adgrv1 A G 13: 81,534,887 (GRCm39) Y5793H probably benign Het
Agmo A G 12: 37,302,538 (GRCm39) D125G probably damaging Het
Ahrr A G 13: 74,368,799 (GRCm39) S125P probably damaging Het
B020011L13Rik C A 1: 117,729,034 (GRCm39) H180Q probably benign Het
Cbfa2t3 T C 8: 123,365,653 (GRCm39) D219G probably damaging Het
Ccdc187 A G 2: 26,165,577 (GRCm39) S860P possibly damaging Het
Ceacam5 A T 7: 17,484,671 (GRCm39) Q471L probably benign Het
Cyp2c54 A C 19: 40,036,030 (GRCm39) D293E probably damaging Het
Dnah1 G T 14: 31,023,805 (GRCm39) N962K probably benign Het
Dst C T 1: 34,229,388 (GRCm39) T2002I probably benign Het
Elavl1 A T 8: 4,339,864 (GRCm39) N239K probably benign Het
Elmod3 A G 6: 72,543,667 (GRCm39) F375L probably benign Het
G6pc2 T A 2: 69,050,469 (GRCm39) N31K probably benign Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm6569 G T 15: 73,711,673 (GRCm39) probably benign Het
Insig1 C T 5: 28,280,116 (GRCm39) S236L probably damaging Het
Itih4 A T 14: 30,622,979 (GRCm39) N882I probably benign Het
Kmt5a C A 5: 124,598,635 (GRCm39) D309E probably benign Het
Kndc1 C A 7: 139,503,669 (GRCm39) T991N probably benign Het
Lingo1 T A 9: 56,528,353 (GRCm39) T79S probably benign Het
Myh4 A T 11: 67,134,335 (GRCm39) E330V probably benign Het
Nlrx1 A G 9: 44,174,070 (GRCm39) V377A probably benign Het
Npy5r C A 8: 67,134,688 (GRCm39) G35V probably benign Het
Or5b102 T A 19: 13,041,432 (GRCm39) I219N probably damaging Het
Or7g33 C T 9: 19,448,605 (GRCm39) G207D possibly damaging Het
Pabpn1l T C 8: 123,349,358 (GRCm39) T20A probably benign Het
Pcf11 A G 7: 92,302,432 (GRCm39) V1226A probably benign Het
Per2 G A 1: 91,351,659 (GRCm39) T949M probably benign Het
Phc1 G A 6: 122,315,539 (GRCm39) probably benign Het
Pias2 A G 18: 77,185,083 (GRCm39) I55V possibly damaging Het
Pik3r2 A T 8: 71,227,312 (GRCm39) S104T probably benign Het
Pip T C 6: 41,828,421 (GRCm39) V85A probably benign Het
Pms2 T C 5: 143,860,445 (GRCm39) V86A probably benign Het
Potefam1 G A 2: 111,058,380 (GRCm39) P138S possibly damaging Het
Rab44 A G 17: 29,363,547 (GRCm39) probably null Het
Rrbp1 A G 2: 143,830,095 (GRCm39) S691P probably damaging Het
Ruvbl2 A T 7: 45,079,118 (GRCm39) probably null Het
Setbp1 T C 18: 78,826,542 (GRCm39) D1357G possibly damaging Het
Slc12a6 T A 2: 112,174,312 (GRCm39) I476N probably damaging Het
Slc1a1 C T 19: 28,882,746 (GRCm39) P337S probably damaging Het
Slc35b3 T A 13: 39,128,566 (GRCm39) T174S probably benign Het
Slc4a4 A T 5: 89,283,581 (GRCm39) I467F probably damaging Het
Slc50a1 G A 3: 89,177,710 (GRCm39) probably null Het
Spink14 G A 18: 44,164,079 (GRCm39) probably null Het
Spmap2l T A 5: 77,207,325 (GRCm39) I361N probably damaging Het
Tmem59 T C 4: 107,043,082 (GRCm39) probably null Het
Tnr G A 1: 159,746,585 (GRCm39) E1235K probably benign Het
Tsnaxip1 A G 8: 106,565,370 (GRCm39) E132G probably damaging Het
Vps54 A G 11: 21,227,706 (GRCm39) N93S probably benign Het
Wdr17 T G 8: 55,101,265 (GRCm39) I994L probably benign Het
Zfat G T 15: 68,037,696 (GRCm39) H926Q probably damaging Het
Zfp2 C T 11: 50,791,627 (GRCm39) E139K possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTGACTAAGCCTGATGTCCAG -3'
(R):5'- TTATGCACTGTGCCCTCTAGG -3'

Sequencing Primer
(F):5'- GTCCACCTGCATGAATCAATGTG -3'
(R):5'- ATGAGGCTCAGAGGGCACTTC -3'
Posted On 2021-01-18