Incidental Mutation 'R8534:Cyp2c54'
ID 659185
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 068503-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8534 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 40036030 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 293 (D293E)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably damaging
Transcript: ENSMUST00000048959
AA Change: D293E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: D293E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A C 2: 19,545,153 (GRCm39) L100R probably damaging Het
6820408C15Rik A G 2: 152,283,182 (GRCm39) D282G probably damaging Het
Abcb11 G T 2: 69,154,190 (GRCm39) N125K possibly damaging Het
Acbd7 A T 2: 3,341,750 (GRCm39) D71V probably damaging Het
Adgrb1 A T 15: 74,415,357 (GRCm39) T646S probably damaging Het
Adgrv1 A G 13: 81,534,887 (GRCm39) Y5793H probably benign Het
Agmo A G 12: 37,302,538 (GRCm39) D125G probably damaging Het
Ahrr A G 13: 74,368,799 (GRCm39) S125P probably damaging Het
B020011L13Rik C A 1: 117,729,034 (GRCm39) H180Q probably benign Het
Cbfa2t3 T C 8: 123,365,653 (GRCm39) D219G probably damaging Het
Ccdc187 A G 2: 26,165,577 (GRCm39) S860P possibly damaging Het
Ceacam5 A T 7: 17,484,671 (GRCm39) Q471L probably benign Het
Dnah1 G T 14: 31,023,805 (GRCm39) N962K probably benign Het
Dst C T 1: 34,229,388 (GRCm39) T2002I probably benign Het
Elavl1 A T 8: 4,339,864 (GRCm39) N239K probably benign Het
Elmod3 A G 6: 72,543,667 (GRCm39) F375L probably benign Het
G6pc2 T A 2: 69,050,469 (GRCm39) N31K probably benign Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gm6569 G T 15: 73,711,673 (GRCm39) probably benign Het
Insig1 C T 5: 28,280,116 (GRCm39) S236L probably damaging Het
Itih4 A T 14: 30,622,979 (GRCm39) N882I probably benign Het
Kmt5a C A 5: 124,598,635 (GRCm39) D309E probably benign Het
Kndc1 C A 7: 139,503,669 (GRCm39) T991N probably benign Het
Lingo1 T A 9: 56,528,353 (GRCm39) T79S probably benign Het
Myh4 A T 11: 67,134,335 (GRCm39) E330V probably benign Het
Nlrx1 A G 9: 44,174,070 (GRCm39) V377A probably benign Het
Npy5r C A 8: 67,134,688 (GRCm39) G35V probably benign Het
Or5b102 T A 19: 13,041,432 (GRCm39) I219N probably damaging Het
Or7g33 C T 9: 19,448,605 (GRCm39) G207D possibly damaging Het
Pabpn1l T C 8: 123,349,358 (GRCm39) T20A probably benign Het
Pcf11 A G 7: 92,302,432 (GRCm39) V1226A probably benign Het
Per2 G A 1: 91,351,659 (GRCm39) T949M probably benign Het
Phc1 G A 6: 122,315,539 (GRCm39) probably benign Het
Pias2 A G 18: 77,185,083 (GRCm39) I55V possibly damaging Het
Pik3r2 A T 8: 71,227,312 (GRCm39) S104T probably benign Het
Pip T C 6: 41,828,421 (GRCm39) V85A probably benign Het
Pms2 T C 5: 143,860,445 (GRCm39) V86A probably benign Het
Potefam1 G A 2: 111,058,380 (GRCm39) P138S possibly damaging Het
Rab44 A G 17: 29,363,547 (GRCm39) probably null Het
Rrbp1 A G 2: 143,830,095 (GRCm39) S691P probably damaging Het
Ruvbl2 A T 7: 45,079,118 (GRCm39) probably null Het
Setbp1 T C 18: 78,826,542 (GRCm39) D1357G possibly damaging Het
Slc12a6 T A 2: 112,174,312 (GRCm39) I476N probably damaging Het
Slc1a1 C T 19: 28,882,746 (GRCm39) P337S probably damaging Het
Slc35b3 T A 13: 39,128,566 (GRCm39) T174S probably benign Het
Slc4a4 A T 5: 89,283,581 (GRCm39) I467F probably damaging Het
Slc50a1 G A 3: 89,177,710 (GRCm39) probably null Het
Spink14 G A 18: 44,164,079 (GRCm39) probably null Het
Spmap2l T A 5: 77,207,325 (GRCm39) I361N probably damaging Het
Tmem59 T C 4: 107,043,082 (GRCm39) probably null Het
Tnr G A 1: 159,746,585 (GRCm39) E1235K probably benign Het
Trpm6 A T 19: 18,869,459 (GRCm39) R2015S probably benign Het
Tsnaxip1 A G 8: 106,565,370 (GRCm39) E132G probably damaging Het
Vps54 A G 11: 21,227,706 (GRCm39) N93S probably benign Het
Wdr17 T G 8: 55,101,265 (GRCm39) I994L probably benign Het
Zfat G T 15: 68,037,696 (GRCm39) H926Q probably damaging Het
Zfp2 C T 11: 50,791,627 (GRCm39) E139K possibly damaging Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCACCCTCCTCATTACAGACAGTG -3'
(R):5'- ATTTAGAGACAGTGTGTTGGCCAC -3'

Sequencing Primer
(F):5'- TCCTCATTACAGACAGTGAAACAG -3'
(R):5'- AGGAAGATGACAATCATCCT -3'
Posted On 2021-01-18