Incidental Mutation 'R8535:Styxl2'
ID 659189
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 068504-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8535 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 165928730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 294 (D294G)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably benign
Transcript: ENSMUST00000085992
AA Change: D294G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: D294G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192369
AA Change: D294G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: D294G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,229,328 (GRCm39) I362F probably damaging Het
Anks1b T A 10: 90,784,493 (GRCm39) S1154T probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Chd7 T A 4: 8,859,211 (GRCm39) S2434T possibly damaging Het
Crybg2 T C 4: 133,808,514 (GRCm39) S1372P probably damaging Het
Dock5 A G 14: 68,031,425 (GRCm39) Y1002H probably benign Het
Dst T C 1: 34,225,082 (GRCm39) S1163P probably damaging Het
Fah A T 7: 84,250,305 (GRCm39) S14T probably benign Het
Gcnt7 T C 2: 172,296,466 (GRCm39) I119M possibly damaging Het
Gja10 G A 4: 32,602,274 (GRCm39) L37F probably damaging Het
Gm10750 A G 2: 148,857,888 (GRCm39) V121A unknown Het
Klhl25 G A 7: 75,515,843 (GRCm39) V250I probably benign Het
Kmt2a A C 9: 44,730,812 (GRCm39) S200R possibly damaging Het
Map1b T A 13: 99,571,662 (GRCm39) D353V probably damaging Het
Myh8 G A 11: 67,169,741 (GRCm39) R20Q probably damaging Het
Or4c127 G A 2: 89,833,511 (GRCm39) V254M probably benign Het
Or6c200-ps1 T C 10: 128,869,892 (GRCm39) Y273C probably damaging Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Pkn3 A T 2: 29,969,936 (GRCm39) probably null Het
Ptpn21 T A 12: 98,646,285 (GRCm39) T1058S probably damaging Het
Ryr3 A G 2: 112,779,433 (GRCm39) probably null Het
Sardh T A 2: 27,129,657 (GRCm39) I263F probably damaging Het
Scart1 G A 7: 139,804,634 (GRCm39) V546M probably benign Het
Sh3bp5 A G 14: 31,139,375 (GRCm39) V66A probably benign Het
Taf4b T A 18: 14,955,195 (GRCm39) S583T probably damaging Het
Tbcb G A 7: 29,926,421 (GRCm39) P132L probably benign Het
Tcirg1 A G 19: 3,946,324 (GRCm39) I791T probably damaging Het
Tmeff2 T A 1: 51,220,985 (GRCm39) V320D probably damaging Het
Tnfrsf19 T C 14: 61,208,417 (GRCm39) E368G probably benign Het
Trdv2-1 T A 14: 54,183,972 (GRCm39) I67N probably damaging Het
Unc13c G A 9: 73,447,653 (GRCm39) T1849I probably benign Het
Vav2 G A 2: 27,161,841 (GRCm39) T655I probably damaging Het
Vps50 T C 6: 3,565,612 (GRCm39) Y517H possibly damaging Het
Wdr27 G A 17: 15,123,799 (GRCm39) T558I possibly damaging Het
Yeats2 C T 16: 19,977,926 (GRCm39) R137W probably damaging Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAACAGCTACGTCCCTTTC -3'
(R):5'- GGTCGCCTACCTGATGATCTTC -3'

Sequencing Primer
(F):5'- TACCCTGAGCAGCCTCC -3'
(R):5'- ACCTGATGATCTTCCACAGCATG -3'
Posted On 2021-01-18