Incidental Mutation 'R8535:Pkn3'
ID 659192
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Name protein kinase N3
Synonyms
MMRRC Submission 068504-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8535 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 29967696-29981034 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 29969936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
AlphaFold Q8K045
Predicted Effect probably null
Transcript: ENSMUST00000045246
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125346
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150770
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,229,328 (GRCm39) I362F probably damaging Het
Anks1b T A 10: 90,784,493 (GRCm39) S1154T probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Chd7 T A 4: 8,859,211 (GRCm39) S2434T possibly damaging Het
Crybg2 T C 4: 133,808,514 (GRCm39) S1372P probably damaging Het
Dock5 A G 14: 68,031,425 (GRCm39) Y1002H probably benign Het
Dst T C 1: 34,225,082 (GRCm39) S1163P probably damaging Het
Fah A T 7: 84,250,305 (GRCm39) S14T probably benign Het
Gcnt7 T C 2: 172,296,466 (GRCm39) I119M possibly damaging Het
Gja10 G A 4: 32,602,274 (GRCm39) L37F probably damaging Het
Gm10750 A G 2: 148,857,888 (GRCm39) V121A unknown Het
Klhl25 G A 7: 75,515,843 (GRCm39) V250I probably benign Het
Kmt2a A C 9: 44,730,812 (GRCm39) S200R possibly damaging Het
Map1b T A 13: 99,571,662 (GRCm39) D353V probably damaging Het
Myh8 G A 11: 67,169,741 (GRCm39) R20Q probably damaging Het
Or4c127 G A 2: 89,833,511 (GRCm39) V254M probably benign Het
Or6c200-ps1 T C 10: 128,869,892 (GRCm39) Y273C probably damaging Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Ptpn21 T A 12: 98,646,285 (GRCm39) T1058S probably damaging Het
Ryr3 A G 2: 112,779,433 (GRCm39) probably null Het
Sardh T A 2: 27,129,657 (GRCm39) I263F probably damaging Het
Scart1 G A 7: 139,804,634 (GRCm39) V546M probably benign Het
Sh3bp5 A G 14: 31,139,375 (GRCm39) V66A probably benign Het
Styxl2 T C 1: 165,928,730 (GRCm39) D294G probably benign Het
Taf4b T A 18: 14,955,195 (GRCm39) S583T probably damaging Het
Tbcb G A 7: 29,926,421 (GRCm39) P132L probably benign Het
Tcirg1 A G 19: 3,946,324 (GRCm39) I791T probably damaging Het
Tmeff2 T A 1: 51,220,985 (GRCm39) V320D probably damaging Het
Tnfrsf19 T C 14: 61,208,417 (GRCm39) E368G probably benign Het
Trdv2-1 T A 14: 54,183,972 (GRCm39) I67N probably damaging Het
Unc13c G A 9: 73,447,653 (GRCm39) T1849I probably benign Het
Vav2 G A 2: 27,161,841 (GRCm39) T655I probably damaging Het
Vps50 T C 6: 3,565,612 (GRCm39) Y517H possibly damaging Het
Wdr27 G A 17: 15,123,799 (GRCm39) T558I possibly damaging Het
Yeats2 C T 16: 19,977,926 (GRCm39) R137W probably damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 29,971,116 (GRCm39) missense probably damaging 0.97
IGL00781:Pkn3 APN 2 29,973,402 (GRCm39) unclassified probably benign
IGL00815:Pkn3 APN 2 29,971,212 (GRCm39) missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 29,977,054 (GRCm39) missense probably damaging 1.00
IGL01897:Pkn3 APN 2 29,972,824 (GRCm39) unclassified probably benign
IGL02513:Pkn3 APN 2 29,973,149 (GRCm39) missense probably damaging 0.98
IGL02552:Pkn3 APN 2 29,970,879 (GRCm39) missense probably damaging 1.00
IGL02622:Pkn3 APN 2 29,973,158 (GRCm39) missense probably benign 0.28
IGL02689:Pkn3 APN 2 29,970,858 (GRCm39) missense probably damaging 1.00
IGL02996:Pkn3 APN 2 29,970,627 (GRCm39) missense probably benign 0.39
IGL03106:Pkn3 APN 2 29,975,257 (GRCm39) missense probably damaging 0.96
Enflamme UTSW 2 29,973,049 (GRCm39) unclassified probably benign
Wrath UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 29,980,539 (GRCm39) missense probably damaging 1.00
R0279:Pkn3 UTSW 2 29,973,309 (GRCm39) missense probably benign 0.16
R0370:Pkn3 UTSW 2 29,977,184 (GRCm39) missense probably damaging 1.00
R0491:Pkn3 UTSW 2 29,979,889 (GRCm39) missense probably damaging 1.00
R0600:Pkn3 UTSW 2 29,971,146 (GRCm39) missense probably benign 0.06
R1418:Pkn3 UTSW 2 29,973,059 (GRCm39) missense probably damaging 1.00
R1510:Pkn3 UTSW 2 29,969,776 (GRCm39) critical splice donor site probably null
R1535:Pkn3 UTSW 2 29,977,065 (GRCm39) missense probably benign
R1540:Pkn3 UTSW 2 29,974,703 (GRCm39) missense probably damaging 1.00
R1808:Pkn3 UTSW 2 29,969,663 (GRCm39) missense probably damaging 1.00
R1884:Pkn3 UTSW 2 29,972,840 (GRCm39) missense probably damaging 1.00
R1995:Pkn3 UTSW 2 29,979,989 (GRCm39) missense probably damaging 1.00
R3745:Pkn3 UTSW 2 29,980,353 (GRCm39) missense probably damaging 1.00
R4119:Pkn3 UTSW 2 29,973,049 (GRCm39) unclassified probably benign
R4258:Pkn3 UTSW 2 29,978,572 (GRCm39) missense probably damaging 0.99
R4665:Pkn3 UTSW 2 29,975,469 (GRCm39) unclassified probably benign
R4772:Pkn3 UTSW 2 29,974,692 (GRCm39) splice site probably null
R4808:Pkn3 UTSW 2 29,980,093 (GRCm39) missense probably damaging 1.00
R5038:Pkn3 UTSW 2 29,975,293 (GRCm39) critical splice donor site probably null
R5388:Pkn3 UTSW 2 29,971,086 (GRCm39) missense probably damaging 0.99
R5488:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R5611:Pkn3 UTSW 2 29,969,673 (GRCm39) missense probably damaging 1.00
R6001:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R6277:Pkn3 UTSW 2 29,972,957 (GRCm39) missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 29,970,699 (GRCm39) critical splice donor site probably null
R6724:Pkn3 UTSW 2 29,980,562 (GRCm39) missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 29,973,548 (GRCm39) splice site probably null
R7128:Pkn3 UTSW 2 29,973,327 (GRCm39) missense probably damaging 1.00
R7249:Pkn3 UTSW 2 29,974,773 (GRCm39) missense probably benign 0.00
R7475:Pkn3 UTSW 2 29,977,122 (GRCm39) missense probably benign 0.01
R7746:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7747:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7783:Pkn3 UTSW 2 29,969,634 (GRCm39) missense probably damaging 1.00
R8401:Pkn3 UTSW 2 29,970,071 (GRCm39) missense probably benign 0.00
R8425:Pkn3 UTSW 2 29,976,513 (GRCm39) critical splice donor site probably null
R8720:Pkn3 UTSW 2 29,975,196 (GRCm39) missense probably benign 0.01
R8743:Pkn3 UTSW 2 29,973,318 (GRCm39) missense probably benign 0.00
R9415:Pkn3 UTSW 2 29,968,332 (GRCm39) missense probably benign 0.20
R9437:Pkn3 UTSW 2 29,973,267 (GRCm39) missense possibly damaging 0.93
R9583:Pkn3 UTSW 2 29,976,723 (GRCm39) missense probably null 0.99
R9800:Pkn3 UTSW 2 29,973,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCATGCCCAAGTTCTG -3'
(R):5'- CTACGTCTCTCCCATCAGGTAG -3'

Sequencing Primer
(F):5'- AAGTTCTGCTGCCAGCCTCAG -3'
(R):5'- TAGATGAGAAGCCAGGCCTACC -3'
Posted On 2021-01-18