Mutagenetix > Incidental Mutation

Incidental Mutation 'R8535:Chd7'

659197

Institutional Source

Beutler Lab

Gene Symbol

Chd7

Ensembl Gene

ENSMUSG00000041235

Gene Name

chromodomain helicase DNA binding protein 7

Synonyms

A730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi

MMRRC Submission

Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R8535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8690406-8867659 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8859211 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2434 (S2434T)

Ref Sequence

ENSEMBL: ENSMUSP00000059079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039267
AA Change: S2434T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: S2434T

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051558
AA Change: S2434T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: S2434T

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170391

SMART Domains

Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
BRK	586	630	3.77e-23	SMART
low complexity region	670	680	N/A	INTRINSIC
low complexity region	701	713	N/A	INTRINSIC
low complexity region	724	733	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	765	776	N/A	INTRINSIC
low complexity region	852	871	N/A	INTRINSIC
low complexity region	922	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222546

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]

Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	A	T	11: 54,338,502	I362F	probably damaging	Het
Anks1b	T	A	10: 90,948,631	S1154T	probably benign	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
Cd163l1	G	A	7: 140,224,721	V546M	probably benign	Het
Crybg2	T	C	4: 134,081,203	S1372P	probably damaging	Het
Dock5	A	G	14: 67,793,976	Y1002H	probably benign	Het
Dst	T	C	1: 34,186,001	S1163P	probably damaging	Het
Dusp27	T	C	1: 166,101,161	D294G	probably benign	Het
Fah	A	T	7: 84,601,097	S14T	probably benign	Het
Gcnt7	T	C	2: 172,454,546	I119M	possibly damaging	Het
Gja10	G	A	4: 32,602,274	L37F	probably damaging	Het
Gm10750	A	G	2: 149,015,968	V121A	unknown	Het
Klhl25	G	A	7: 75,866,095	V250I	probably benign	Het
Kmt2a	A	C	9: 44,819,515	S200R	possibly damaging	Het
Map1b	T	A	13: 99,435,154	D353V	probably damaging	Het
Myh8	G	A	11: 67,278,915	R20Q	probably damaging	Het
Olfr1262	G	A	2: 90,003,167	V254M	probably benign	Het
Olfr764-ps1	T	C	10: 129,034,023	Y273C	probably damaging	Het
Pcnt	G	A	10: 76,420,205	R734W	probably damaging	Het
Pkn3	A	T	2: 30,079,924		probably null	Het
Ptpn21	T	A	12: 98,680,026	T1058S	probably damaging	Het
Ryr3	A	G	2: 112,949,088		probably null	Het
Sardh	T	A	2: 27,239,645	I263F	probably damaging	Het
Sh3bp5	A	G	14: 31,417,418	V66A	probably benign	Het
Taf4b	T	A	18: 14,822,138	S583T	probably damaging	Het
Tbcb	G	A	7: 30,226,996	P132L	probably benign	Het
Tcirg1	A	G	19: 3,896,324	I791T	probably damaging	Het
Tmeff2	T	A	1: 51,181,826	V320D	probably damaging	Het
Tnfrsf19	T	C	14: 60,970,968	E368G	probably benign	Het
Trdv2-1	T	A	14: 53,946,515	I67N	probably damaging	Het
Unc13c	G	A	9: 73,540,371	T1849I	probably benign	Het
Vav2	G	A	2: 27,271,829	T655I	probably damaging	Het
Vps50	T	C	6: 3,565,612	Y517H	possibly damaging	Het
Wdr27	G	A	17: 14,903,537	T558I	possibly damaging	Het
Yeats2	C	T	16: 20,159,176	R137W	probably damaging	Het

Other mutations in Chd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Chd7	APN	4	8859106	missense	probably damaging	1.00
IGL00510:Chd7	APN	4	8801404	missense	probably damaging	1.00
IGL00741:Chd7	APN	4	8839454	missense	probably damaging	1.00
IGL00796:Chd7	APN	4	8847271	missense	possibly damaging	0.95
IGL00907:Chd7	APN	4	8840435	missense	probably damaging	0.98
IGL00930:Chd7	APN	4	8805181	missense	probably damaging	1.00
IGL01542:Chd7	APN	4	8859285	missense	possibly damaging	0.71
IGL01602:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01605:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01670:Chd7	APN	4	8827033	missense	probably damaging	0.98
IGL02434:Chd7	APN	4	8752145	missense	probably benign	0.00
IGL02531:Chd7	APN	4	8854134	missense	probably damaging	1.00
IGL02626:Chd7	APN	4	8826519	missense	probably damaging	1.00
IGL02961:Chd7	APN	4	8751542	missense	probably damaging	1.00
IGL02972:Chd7	APN	4	8855174	missense	probably benign	0.30
IGL03329:Chd7	APN	4	8841108	missense	probably damaging	1.00
Fili	UTSW	4	8839523	missense	probably damaging	1.00
D4043:Chd7	UTSW	4	8862650	missense	probably damaging	1.00
IGL02991:Chd7	UTSW	4	8828398	missense	possibly damaging	0.91
PIT4466001:Chd7	UTSW	4	8753101	missense	unknown
PIT4472001:Chd7	UTSW	4	8753101	missense	unknown
R0157:Chd7	UTSW	4	8833759	missense	probably damaging	1.00
R0179:Chd7	UTSW	4	8862516	missense	probably benign	0.22
R0240:Chd7	UTSW	4	8852670	unclassified	probably benign
R0388:Chd7	UTSW	4	8854560	missense	probably benign	0.27
R0462:Chd7	UTSW	4	8850821	missense	probably damaging	1.00
R0512:Chd7	UTSW	4	8805139	intron	probably benign
R0657:Chd7	UTSW	4	8753141	missense	probably damaging	1.00
R0799:Chd7	UTSW	4	8801310	intron	probably benign
R0885:Chd7	UTSW	4	8866432	missense	probably damaging	1.00
R1056:Chd7	UTSW	4	8822402	missense	possibly damaging	0.50
R1086:Chd7	UTSW	4	8866458	missense	probably benign	0.04
R1353:Chd7	UTSW	4	8839556	missense	probably damaging	0.99
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1605:Chd7	UTSW	4	8844675	missense	probably damaging	1.00
R1693:Chd7	UTSW	4	8864307	critical splice donor site	probably null
R1695:Chd7	UTSW	4	8833960	missense	probably damaging	1.00
R1938:Chd7	UTSW	4	8847200	missense	probably damaging	1.00
R1964:Chd7	UTSW	4	8865978	missense	probably damaging	0.96
R2020:Chd7	UTSW	4	8855226	missense	probably benign	0.00
R2134:Chd7	UTSW	4	8753147	missense	probably damaging	0.99
R2171:Chd7	UTSW	4	8752424	missense	probably damaging	1.00
R2271:Chd7	UTSW	4	8785532	missense	probably damaging	1.00
R2300:Chd7	UTSW	4	8855241	missense	probably benign	0.02
R2355:Chd7	UTSW	4	8801350	missense	possibly damaging	0.95
R3153:Chd7	UTSW	4	8855174	missense	probably benign	0.30
R3430:Chd7	UTSW	4	8844517	missense	probably damaging	0.99
R3746:Chd7	UTSW	4	8752537	missense	probably damaging	1.00
R4118:Chd7	UTSW	4	8865831	missense	probably damaging	1.00
R4119:Chd7	UTSW	4	8785658	intron	probably benign
R4332:Chd7	UTSW	4	8854143	missense	probably damaging	1.00
R4402:Chd7	UTSW	4	8866353	missense	possibly damaging	0.61
R4571:Chd7	UTSW	4	8866217	missense	probably benign	0.09
R4722:Chd7	UTSW	4	8822445	missense	probably damaging	1.00
R4821:Chd7	UTSW	4	8844706	missense	probably damaging	1.00
R4894:Chd7	UTSW	4	8838629	missense	probably damaging	0.99
R5205:Chd7	UTSW	4	8752509	missense	possibly damaging	0.60
R5344:Chd7	UTSW	4	8844417	missense	probably damaging	1.00
R5484:Chd7	UTSW	4	8828258	missense	probably damaging	1.00
R5578:Chd7	UTSW	4	8847149	missense	probably benign	0.09
R5583:Chd7	UTSW	4	8752473	missense	probably damaging	1.00
R5888:Chd7	UTSW	4	8866382	missense	probably damaging	0.98
R5905:Chd7	UTSW	4	8840553	missense	possibly damaging	0.91
R6091:Chd7	UTSW	4	8751875	missense	probably damaging	0.99
R6126:Chd7	UTSW	4	8826482	missense	probably damaging	1.00
R6399:Chd7	UTSW	4	8828274	missense	probably damaging	1.00
R6751:Chd7	UTSW	4	8833866	missense	probably damaging	1.00
R6810:Chd7	UTSW	4	8839523	missense	probably damaging	1.00
R6868:Chd7	UTSW	4	8811501	splice site	probably null
R6952:Chd7	UTSW	4	8856797	missense	probably damaging	1.00
R6986:Chd7	UTSW	4	8859285	missense	possibly damaging	0.71
R6990:Chd7	UTSW	4	8844525	missense	probably benign	0.28
R7139:Chd7	UTSW	4	8865865	missense	probably benign	0.00
R7288:Chd7	UTSW	4	8847093	missense	possibly damaging	0.92
R7355:Chd7	UTSW	4	8752196	missense	unknown
R7452:Chd7	UTSW	4	8854731	missense	probably benign	0.03
R7471:Chd7	UTSW	4	8859197	missense	probably damaging	0.96
R7588:Chd7	UTSW	4	8864039	missense	probably damaging	1.00
R7711:Chd7	UTSW	4	8805234	missense	probably benign	0.00
R7744:Chd7	UTSW	4	8862485	splice site	probably null
R7842:Chd7	UTSW	4	8854115	missense	probably benign	0.01
R7883:Chd7	UTSW	4	8826504	missense	probably damaging	1.00
R7934:Chd7	UTSW	4	8854121	missense	probably benign	0.00
R7983:Chd7	UTSW	4	8752628	missense	unknown
R7983:Chd7	UTSW	4	8844609	missense	possibly damaging	0.47
R8022:Chd7	UTSW	4	8751605	missense	unknown
R8161:Chd7	UTSW	4	8855038	missense	probably damaging	1.00
R8274:Chd7	UTSW	4	8839432	missense	probably damaging	1.00
R8278:Chd7	UTSW	4	8862485	splice site	probably null
R8358:Chd7	UTSW	4	8839529	missense	probably damaging	1.00
R8464:Chd7	UTSW	4	8811465	missense	probably benign	0.06
R8483:Chd7	UTSW	4	8822412	missense	possibly damaging	0.65
R8507:Chd7	UTSW	4	8858675	missense	probably damaging	1.00
R8695:Chd7	UTSW	4	8850812	missense	probably damaging	1.00
R8700:Chd7	UTSW	4	8833892	missense	probably damaging	1.00
R8755:Chd7	UTSW	4	8866069	missense	probably benign	0.31
R8774:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8774-TAIL:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8796:Chd7	UTSW	4	8838691	missense	probably damaging	1.00
R8992:Chd7	UTSW	4	8839589	missense	probably damaging	1.00
R9018:Chd7	UTSW	4	8847083	missense	possibly damaging	0.88
R9122:Chd7	UTSW	4	8840510	missense	possibly damaging	0.77
R9131:Chd7	UTSW	4	8785642	missense
R9182:Chd7	UTSW	4	8838737	missense	probably damaging	1.00
R9227:Chd7	UTSW	4	8805272	missense	probably benign	0.03
R9254:Chd7	UTSW	4	8752210	missense	unknown
R9379:Chd7	UTSW	4	8752210	missense	unknown
R9388:Chd7	UTSW	4	8865756	missense	possibly damaging	0.89
R9455:Chd7	UTSW	4	8752061	missense	unknown
R9531:Chd7	UTSW	4	8858489	missense
R9577:Chd7	UTSW	4	8752964	missense	unknown
R9634:Chd7	UTSW	4	8832499	missense	probably damaging	1.00
Z1176:Chd7	UTSW	4	8844313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCCCTATTGCAGATAAAGG -3'
(R):5'- GCCATTGAGCATATGCCTTG -3'

Sequencing Primer
(F):5'- GGGAATTTTCAATAGGATGATGCCC -3'
(R):5'- CATTGAGCATATGCCTTGTGGGTG -3'

Posted On

2021-01-18