Mutagenetix > Incidental Mutation

Incidental Mutation 'R8535:Klhl25'

659202

Institutional Source

Beutler Lab

Gene Symbol

Klhl25

Ensembl Gene

ENSMUSG00000055652

Gene Name

kelch-like 25

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R8535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75848310-75874131 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 75866095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 250 (V250I)

Ref Sequence

ENSEMBL: ENSMUSP00000146102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092073] [ENSMUST00000171155] [ENSMUST00000205612] [ENSMUST00000205887] [ENSMUST00000206019]

AlphaFold

Q8R2P1

Predicted Effect

probably benign
Transcript: ENSMUST00000092073
AA Change: V250I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000089707
Gene: ENSMUSG00000055652
AA Change: V250I

Domain	Start	End	E-Value	Type
BTB	46	144	2.43e-28	SMART
BACK	149	251	1.06e-32	SMART
Blast:BTB	256	294	1e-9	BLAST
Kelch	296	340	1.4e0	SMART
Kelch	341	388	6.71e-10	SMART
Kelch	389	444	2.25e-11	SMART
Kelch	445	492	1.22e-1	SMART
Kelch	493	538	1.92e-5	SMART
Kelch	539	585	1.4e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171155
AA Change: V250I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133175
Gene: ENSMUSG00000055652
AA Change: V250I

Domain	Start	End	E-Value	Type
BTB	46	144	2.43e-28	SMART
BACK	149	251	1.06e-32	SMART
Blast:BTB	256	294	1e-9	BLAST
Kelch	296	340	1.4e0	SMART
Kelch	341	388	6.71e-10	SMART
Kelch	389	444	2.25e-11	SMART
Kelch	445	492	1.22e-1	SMART
Kelch	493	538	1.92e-5	SMART
Kelch	539	585	1.4e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205612

Predicted Effect

probably benign
Transcript: ENSMUST00000205887

Predicted Effect

probably benign
Transcript: ENSMUST00000206019
AA Change: V250I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (34/34)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	A	T	11: 54,338,502	I362F	probably damaging	Het
Anks1b	T	A	10: 90,948,631	S1154T	probably benign	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
Cd163l1	G	A	7: 140,224,721	V546M	probably benign	Het
Chd7	T	A	4: 8,859,211	S2434T	possibly damaging	Het
Crybg2	T	C	4: 134,081,203	S1372P	probably damaging	Het
Dock5	A	G	14: 67,793,976	Y1002H	probably benign	Het
Dst	T	C	1: 34,186,001	S1163P	probably damaging	Het
Dusp27	T	C	1: 166,101,161	D294G	probably benign	Het
Fah	A	T	7: 84,601,097	S14T	probably benign	Het
Gcnt7	T	C	2: 172,454,546	I119M	possibly damaging	Het
Gja10	G	A	4: 32,602,274	L37F	probably damaging	Het
Gm10750	A	G	2: 149,015,968	V121A	unknown	Het
Kmt2a	A	C	9: 44,819,515	S200R	possibly damaging	Het
Map1b	T	A	13: 99,435,154	D353V	probably damaging	Het
Myh8	G	A	11: 67,278,915	R20Q	probably damaging	Het
Olfr1262	G	A	2: 90,003,167	V254M	probably benign	Het
Olfr764-ps1	T	C	10: 129,034,023	Y273C	probably damaging	Het
Pcnt	G	A	10: 76,420,205	R734W	probably damaging	Het
Pkn3	A	T	2: 30,079,924		probably null	Het
Ptpn21	T	A	12: 98,680,026	T1058S	probably damaging	Het
Ryr3	A	G	2: 112,949,088		probably null	Het
Sardh	T	A	2: 27,239,645	I263F	probably damaging	Het
Sh3bp5	A	G	14: 31,417,418	V66A	probably benign	Het
Taf4b	T	A	18: 14,822,138	S583T	probably damaging	Het
Tbcb	G	A	7: 30,226,996	P132L	probably benign	Het
Tcirg1	A	G	19: 3,896,324	I791T	probably damaging	Het
Tmeff2	T	A	1: 51,181,826	V320D	probably damaging	Het
Tnfrsf19	T	C	14: 60,970,968	E368G	probably benign	Het
Trdv2-1	T	A	14: 53,946,515	I67N	probably damaging	Het
Unc13c	G	A	9: 73,540,371	T1849I	probably benign	Het
Vav2	G	A	2: 27,271,829	T655I	probably damaging	Het
Vps50	T	C	6: 3,565,612	Y517H	possibly damaging	Het
Wdr27	G	A	17: 14,903,537	T558I	possibly damaging	Het
Yeats2	C	T	16: 20,159,176	R137W	probably damaging	Het

Other mutations in Klhl25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Klhl25	APN	7	75866149	nonsense	probably null
IGL01142:Klhl25	APN	7	75866596	missense	probably damaging	1.00
IGL01295:Klhl25	APN	7	75865872	missense	probably benign	0.20
IGL02272:Klhl25	APN	7	75866620	missense	probably benign
IGL02721:Klhl25	APN	7	75866900	missense	probably damaging	1.00
R0196:Klhl25	UTSW	7	75865702	missense	probably damaging	1.00
R0365:Klhl25	UTSW	7	75866516	missense	probably damaging	1.00
R0828:Klhl25	UTSW	7	75866195	missense	probably damaging	0.99
R0881:Klhl25	UTSW	7	75866279	missense	probably damaging	1.00
R1061:Klhl25	UTSW	7	75866520	nonsense	probably null
R1228:Klhl25	UTSW	7	75866120	missense	probably benign
R1696:Klhl25	UTSW	7	75866843	missense	probably damaging	1.00
R1991:Klhl25	UTSW	7	75866732	missense	probably damaging	1.00
R2118:Klhl25	UTSW	7	75866732	missense	probably damaging	1.00
R4359:Klhl25	UTSW	7	75866732	missense	probably damaging	1.00
R4428:Klhl25	UTSW	7	75865414	missense	probably damaging	0.97
R4431:Klhl25	UTSW	7	75865414	missense	probably damaging	0.97
R4717:Klhl25	UTSW	7	75866780	missense	probably damaging	1.00
R4860:Klhl25	UTSW	7	75867050	missense	probably benign	0.03
R4860:Klhl25	UTSW	7	75867050	missense	probably benign	0.03
R5619:Klhl25	UTSW	7	75866854	missense	probably benign	0.22
R5637:Klhl25	UTSW	7	75865792	splice site	probably null
R5652:Klhl25	UTSW	7	75866147	missense	probably benign	0.06
R5840:Klhl25	UTSW	7	75866692	missense	possibly damaging	0.92
R6693:Klhl25	UTSW	7	75866813	missense	possibly damaging	0.91
R6723:Klhl25	UTSW	7	75865991	missense	possibly damaging	0.64
R6875:Klhl25	UTSW	7	75866342	missense	probably damaging	1.00
R7239:Klhl25	UTSW	7	75866768	missense	probably benign	0.25
R8712:Klhl25	UTSW	7	75865672	missense	probably damaging	0.99
R8768:Klhl25	UTSW	7	75866611	missense	probably damaging	1.00
R8827:Klhl25	UTSW	7	75866643	missense	possibly damaging	0.70
R9033:Klhl25	UTSW	7	75866933	missense	probably damaging	0.98
R9046:Klhl25	UTSW	7	75865589	missense	probably damaging	1.00
R9404:Klhl25	UTSW	7	75865405	missense	probably benign	0.01
R9480:Klhl25	UTSW	7	75866372	missense	probably damaging	0.99
R9601:Klhl25	UTSW	7	75866009	missense	probably damaging	1.00
R9762:Klhl25	UTSW	7	75866993	missense	probably damaging	1.00
Z1177:Klhl25	UTSW	7	75866122	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- ACGCTGTTGGACCTCATCTC -3'
(R):5'- CTGCCTTGGGGATAATCTCCTTG -3'

Sequencing Primer
(F):5'- GTTGGACCTCATCTCCAGAG -3'
(R):5'- GGTAGATCTTGTCACACATGAAGGTC -3'

Posted On

2021-01-18