Incidental Mutation 'R8535:Cd163l1'
ID 659204
Institutional Source Beutler Lab
Gene Symbol Cd163l1
Ensembl Gene ENSMUSG00000025461
Gene Name CD163 molecule-like 1
Synonyms E430002D04Rik, Scart1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8535 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140218267-140231145 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 140224721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 546 (V546M)
Ref Sequence ENSEMBL: ENSMUSP00000147864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084460] [ENSMUST00000209398] [ENSMUST00000209637]
AlphaFold A0A1B0GSB0
Predicted Effect probably benign
Transcript: ENSMUST00000084460
AA Change: V546M

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081497
Gene: ENSMUSG00000025461
AA Change: V546M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SR 32 132 1.45e-30 SMART
SR 139 230 4.28e-6 SMART
SR 235 333 2.76e-36 SMART
SR 335 435 1.32e-33 SMART
SR 441 541 5.01e-25 SMART
SR 546 646 7.16e-53 SMART
SR 651 752 3.44e-14 SMART
SR 780 880 8.96e-45 SMART
low complexity region 882 898 N/A INTRINSIC
transmembrane domain 907 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209398
AA Change: V546M

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000209637
AA Change: V546M

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,338,502 I362F probably damaging Het
Anks1b T A 10: 90,948,631 S1154T probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Chd7 T A 4: 8,859,211 S2434T possibly damaging Het
Crybg2 T C 4: 134,081,203 S1372P probably damaging Het
Dock5 A G 14: 67,793,976 Y1002H probably benign Het
Dst T C 1: 34,186,001 S1163P probably damaging Het
Dusp27 T C 1: 166,101,161 D294G probably benign Het
Fah A T 7: 84,601,097 S14T probably benign Het
Gcnt7 T C 2: 172,454,546 I119M possibly damaging Het
Gja10 G A 4: 32,602,274 L37F probably damaging Het
Gm10750 A G 2: 149,015,968 V121A unknown Het
Klhl25 G A 7: 75,866,095 V250I probably benign Het
Kmt2a A C 9: 44,819,515 S200R possibly damaging Het
Map1b T A 13: 99,435,154 D353V probably damaging Het
Myh8 G A 11: 67,278,915 R20Q probably damaging Het
Olfr1262 G A 2: 90,003,167 V254M probably benign Het
Olfr764-ps1 T C 10: 129,034,023 Y273C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pkn3 A T 2: 30,079,924 probably null Het
Ptpn21 T A 12: 98,680,026 T1058S probably damaging Het
Ryr3 A G 2: 112,949,088 probably null Het
Sardh T A 2: 27,239,645 I263F probably damaging Het
Sh3bp5 A G 14: 31,417,418 V66A probably benign Het
Taf4b T A 18: 14,822,138 S583T probably damaging Het
Tbcb G A 7: 30,226,996 P132L probably benign Het
Tcirg1 A G 19: 3,896,324 I791T probably damaging Het
Tmeff2 T A 1: 51,181,826 V320D probably damaging Het
Tnfrsf19 T C 14: 60,970,968 E368G probably benign Het
Trdv2-1 T A 14: 53,946,515 I67N probably damaging Het
Unc13c G A 9: 73,540,371 T1849I probably benign Het
Vav2 G A 2: 27,271,829 T655I probably damaging Het
Vps50 T C 6: 3,565,612 Y517H possibly damaging Het
Wdr27 G A 17: 14,903,537 T558I possibly damaging Het
Yeats2 C T 16: 20,159,176 R137W probably damaging Het
Other mutations in Cd163l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cd163l1 APN 7 140224639 critical splice donor site probably null
IGL01921:Cd163l1 APN 7 140228719 nonsense probably null
IGL02168:Cd163l1 APN 7 140223486 missense probably benign 0.02
IGL02306:Cd163l1 APN 7 140223356 missense probably damaging 1.00
IGL02323:Cd163l1 APN 7 140228659 missense probably benign 0.10
IGL02457:Cd163l1 APN 7 140220395 missense probably benign 0.07
IGL02543:Cd163l1 APN 7 140220578 missense probably benign 0.00
IGL02831:Cd163l1 APN 7 140228521 missense probably benign 0.14
IGL03289:Cd163l1 APN 7 140229060 critical splice donor site probably null
lop UTSW 7 140224463 missense possibly damaging 0.91
R0357:Cd163l1 UTSW 7 140227895 missense probably damaging 1.00
R0513:Cd163l1 UTSW 7 140224960 nonsense probably null
R1023:Cd163l1 UTSW 7 140224463 missense possibly damaging 0.91
R1519:Cd163l1 UTSW 7 140228156 missense probably benign 0.07
R1711:Cd163l1 UTSW 7 140220609 missense probably damaging 1.00
R2327:Cd163l1 UTSW 7 140223977 missense possibly damaging 0.48
R4957:Cd163l1 UTSW 7 140228522 missense probably damaging 0.99
R5421:Cd163l1 UTSW 7 140223900 missense probably damaging 1.00
R5422:Cd163l1 UTSW 7 140224155 missense probably benign 0.03
R5851:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
R5906:Cd163l1 UTSW 7 140228799 missense probably damaging 1.00
R5930:Cd163l1 UTSW 7 140230446 missense probably benign 0.32
R6376:Cd163l1 UTSW 7 140228729 missense probably damaging 1.00
R7380:Cd163l1 UTSW 7 140224877 missense possibly damaging 0.47
R7389:Cd163l1 UTSW 7 140228791 missense possibly damaging 0.95
R7466:Cd163l1 UTSW 7 140220706 critical splice donor site probably null
R7686:Cd163l1 UTSW 7 140222203 nonsense probably null
R7722:Cd163l1 UTSW 7 140222386 nonsense probably null
R8900:Cd163l1 UTSW 7 140228565 nonsense probably null
R9041:Cd163l1 UTSW 7 140228590 missense probably damaging 1.00
R9116:Cd163l1 UTSW 7 140228364 missense probably benign
R9319:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
Z1176:Cd163l1 UTSW 7 140224857 missense probably benign 0.17
Z1186:Cd163l1 UTSW 7 140224490 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATGATGCTCCAGCTCCTATTTTCAG -3'
(R):5'- ATCCATCCAGATGTGCCCAG -3'

Sequencing Primer
(F):5'- CTGCCTGGGCTCTGAGACTC -3'
(R):5'- AGATGTGCCCAGTCCCC -3'
Posted On 2021-01-18