Incidental Mutation 'R8535:Myh8'
ID 659212
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Name myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms Myhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock # R8535 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67277124-67308634 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67278915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 20 (R20Q)
Ref Sequence ENSEMBL: ENSMUSP00000104325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625] [ENSMUST00000108685]
AlphaFold P13542
Predicted Effect probably damaging
Transcript: ENSMUST00000019625
AA Change: R20Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: R20Q

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108685
AA Change: R20Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104325
Gene: ENSMUSG00000055775
AA Change: R20Q

DomainStartEndE-ValueType
Pfam:Myosin_N 37 78 3.8e-17 PFAM
Pfam:Myosin_head 90 172 1.7e-31 PFAM
Meta Mutation Damage Score 0.1569 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,338,502 I362F probably damaging Het
Anks1b T A 10: 90,948,631 S1154T probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cd163l1 G A 7: 140,224,721 V546M probably benign Het
Chd7 T A 4: 8,859,211 S2434T possibly damaging Het
Crybg2 T C 4: 134,081,203 S1372P probably damaging Het
Dock5 A G 14: 67,793,976 Y1002H probably benign Het
Dst T C 1: 34,186,001 S1163P probably damaging Het
Dusp27 T C 1: 166,101,161 D294G probably benign Het
Fah A T 7: 84,601,097 S14T probably benign Het
Gcnt7 T C 2: 172,454,546 I119M possibly damaging Het
Gja10 G A 4: 32,602,274 L37F probably damaging Het
Gm10750 A G 2: 149,015,968 V121A unknown Het
Klhl25 G A 7: 75,866,095 V250I probably benign Het
Kmt2a A C 9: 44,819,515 S200R possibly damaging Het
Map1b T A 13: 99,435,154 D353V probably damaging Het
Olfr1262 G A 2: 90,003,167 V254M probably benign Het
Olfr764-ps1 T C 10: 129,034,023 Y273C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pkn3 A T 2: 30,079,924 probably null Het
Ptpn21 T A 12: 98,680,026 T1058S probably damaging Het
Ryr3 A G 2: 112,949,088 probably null Het
Sardh T A 2: 27,239,645 I263F probably damaging Het
Sh3bp5 A G 14: 31,417,418 V66A probably benign Het
Taf4b T A 18: 14,822,138 S583T probably damaging Het
Tbcb G A 7: 30,226,996 P132L probably benign Het
Tcirg1 A G 19: 3,896,324 I791T probably damaging Het
Tmeff2 T A 1: 51,181,826 V320D probably damaging Het
Tnfrsf19 T C 14: 60,970,968 E368G probably benign Het
Trdv2-1 T A 14: 53,946,515 I67N probably damaging Het
Unc13c G A 9: 73,540,371 T1849I probably benign Het
Vav2 G A 2: 27,271,829 T655I probably damaging Het
Vps50 T C 6: 3,565,612 Y517H possibly damaging Het
Wdr27 G A 17: 14,903,537 T558I possibly damaging Het
Yeats2 C T 16: 20,159,176 R137W probably damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
BB003:Myh8 UTSW 11 67278906 missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67294604 missense probably benign 0.00
BB013:Myh8 UTSW 11 67278906 missense possibly damaging 0.94
BB019:Myh8 UTSW 11 67294604 missense probably benign 0.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7498:Myh8 UTSW 11 67283437 missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67298652 missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67303655 missense probably benign 0.44
R7825:Myh8 UTSW 11 67303712 missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67283818 missense probably damaging 0.97
R7926:Myh8 UTSW 11 67278906 missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67294604 missense probably benign 0.00
R8003:Myh8 UTSW 11 67299760 missense probably damaging 1.00
R8028:Myh8 UTSW 11 67303676 missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67289821 missense probably benign 0.00
R8125:Myh8 UTSW 11 67299772 missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67288266 missense probably benign 0.30
R8277:Myh8 UTSW 11 67292909 missense probably benign 0.10
R8304:Myh8 UTSW 11 67304336 missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67283614 missense possibly damaging 0.94
R8795:Myh8 UTSW 11 67283377 critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67301994 missense possibly damaging 0.67
R8927:Myh8 UTSW 11 67283255 missense probably benign 0.10
R8928:Myh8 UTSW 11 67283255 missense probably benign 0.10
R9031:Myh8 UTSW 11 67299315 missense possibly damaging 0.49
R9172:Myh8 UTSW 11 67292434 missense possibly damaging 0.82
R9252:Myh8 UTSW 11 67286476 missense probably damaging 1.00
R9365:Myh8 UTSW 11 67283806 missense probably benign 0.42
R9468:Myh8 UTSW 11 67306904 missense probably damaging 1.00
R9564:Myh8 UTSW 11 67286389 missense probably benign 0.40
R9565:Myh8 UTSW 11 67286389 missense probably benign 0.40
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67303674 missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67301424 missense probably damaging 0.99
Z1177:Myh8 UTSW 11 67308355 missense possibly damaging 0.64
Z1187:Myh8 UTSW 11 67297486 missense probably benign
Z1188:Myh8 UTSW 11 67297486 missense probably benign
Z1190:Myh8 UTSW 11 67297486 missense probably benign
Z1191:Myh8 UTSW 11 67297486 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGGACACTTGCCAAGTTC -3'
(R):5'- TGAGCCAGAGAAATGATCCCAG -3'

Sequencing Primer
(F):5'- GGACACTTGCCAAGTTCTAAAACTGG -3'
(R):5'- CCAGAGAAATGATCCCAGAGAGG -3'
Posted On 2021-01-18