Incidental Mutation 'R8535:Taf4b'
ID 659221
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R8535 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 14783245-14900359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14822138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 583 (S583T)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: S583T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: S583T

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,338,502 I362F probably damaging Het
Anks1b T A 10: 90,948,631 S1154T probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cd163l1 G A 7: 140,224,721 V546M probably benign Het
Chd7 T A 4: 8,859,211 S2434T possibly damaging Het
Crybg2 T C 4: 134,081,203 S1372P probably damaging Het
Dock5 A G 14: 67,793,976 Y1002H probably benign Het
Dst T C 1: 34,186,001 S1163P probably damaging Het
Dusp27 T C 1: 166,101,161 D294G probably benign Het
Fah A T 7: 84,601,097 S14T probably benign Het
Gcnt7 T C 2: 172,454,546 I119M possibly damaging Het
Gja10 G A 4: 32,602,274 L37F probably damaging Het
Gm10750 A G 2: 149,015,968 V121A unknown Het
Klhl25 G A 7: 75,866,095 V250I probably benign Het
Kmt2a A C 9: 44,819,515 S200R possibly damaging Het
Map1b T A 13: 99,435,154 D353V probably damaging Het
Myh8 G A 11: 67,278,915 R20Q probably damaging Het
Olfr1262 G A 2: 90,003,167 V254M probably benign Het
Olfr764-ps1 T C 10: 129,034,023 Y273C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pkn3 A T 2: 30,079,924 probably null Het
Ptpn21 T A 12: 98,680,026 T1058S probably damaging Het
Ryr3 A G 2: 112,949,088 probably null Het
Sardh T A 2: 27,239,645 I263F probably damaging Het
Sh3bp5 A G 14: 31,417,418 V66A probably benign Het
Tbcb G A 7: 30,226,996 P132L probably benign Het
Tcirg1 A G 19: 3,896,324 I791T probably damaging Het
Tmeff2 T A 1: 51,181,826 V320D probably damaging Het
Tnfrsf19 T C 14: 60,970,968 E368G probably benign Het
Trdv2-1 T A 14: 53,946,515 I67N probably damaging Het
Unc13c G A 9: 73,540,371 T1849I probably benign Het
Vav2 G A 2: 27,271,829 T655I probably damaging Het
Vps50 T C 6: 3,565,612 Y517H possibly damaging Het
Wdr27 G A 17: 14,903,537 T558I possibly damaging Het
Yeats2 C T 16: 20,159,176 R137W probably damaging Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
R8772:Taf4b UTSW 18 14835852 missense probably damaging 1.00
R8805:Taf4b UTSW 18 14813428 missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14830070 missense probably benign 0.39
R9155:Taf4b UTSW 18 14813239 missense probably benign 0.00
R9254:Taf4b UTSW 18 14813374 missense probably damaging 0.98
R9338:Taf4b UTSW 18 14821498 missense probably benign 0.00
R9379:Taf4b UTSW 18 14813374 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATAGTTCTGGGCAGCTTAAGAC -3'
(R):5'- AGCATGTACAATTTGTGTCTGC -3'

Sequencing Primer
(F):5'- TTGGGAAGAGGTATTCTACT -3'
(R):5'- AGGTTATGAACTGCCACGTG -3'
Posted On 2021-01-18