Incidental Mutation 'R8535:Tcirg1'
ID 659222
Institutional Source Beutler Lab
Gene Symbol Tcirg1
Ensembl Gene ENSMUSG00000001750
Gene Name T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms Atp6i, V-ATPase a3, ATP6a3, TIRC7, OC-116
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock # R8535 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 3896050-3907133 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3896324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 791 (I791T)
Ref Sequence ENSEMBL: ENSMUSP00000122474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000128694] [ENSMUST00000135070] [ENSMUST00000145791]
AlphaFold Q9JHF5
Predicted Effect probably damaging
Transcript: ENSMUST00000001801
AA Change: I791T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: I791T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025760
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072055
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122885
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126070
AA Change: I791T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: I791T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132164
SMART Domains Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 190 4.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145791
AA Change: I791T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: I791T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,338,502 I362F probably damaging Het
Anks1b T A 10: 90,948,631 S1154T probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cd163l1 G A 7: 140,224,721 V546M probably benign Het
Chd7 T A 4: 8,859,211 S2434T possibly damaging Het
Crybg2 T C 4: 134,081,203 S1372P probably damaging Het
Dock5 A G 14: 67,793,976 Y1002H probably benign Het
Dst T C 1: 34,186,001 S1163P probably damaging Het
Dusp27 T C 1: 166,101,161 D294G probably benign Het
Fah A T 7: 84,601,097 S14T probably benign Het
Gcnt7 T C 2: 172,454,546 I119M possibly damaging Het
Gja10 G A 4: 32,602,274 L37F probably damaging Het
Gm10750 A G 2: 149,015,968 V121A unknown Het
Klhl25 G A 7: 75,866,095 V250I probably benign Het
Kmt2a A C 9: 44,819,515 S200R possibly damaging Het
Map1b T A 13: 99,435,154 D353V probably damaging Het
Myh8 G A 11: 67,278,915 R20Q probably damaging Het
Olfr1262 G A 2: 90,003,167 V254M probably benign Het
Olfr764-ps1 T C 10: 129,034,023 Y273C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pkn3 A T 2: 30,079,924 probably null Het
Ptpn21 T A 12: 98,680,026 T1058S probably damaging Het
Ryr3 A G 2: 112,949,088 probably null Het
Sardh T A 2: 27,239,645 I263F probably damaging Het
Sh3bp5 A G 14: 31,417,418 V66A probably benign Het
Taf4b T A 18: 14,822,138 S583T probably damaging Het
Tbcb G A 7: 30,226,996 P132L probably benign Het
Tmeff2 T A 1: 51,181,826 V320D probably damaging Het
Tnfrsf19 T C 14: 60,970,968 E368G probably benign Het
Trdv2-1 T A 14: 53,946,515 I67N probably damaging Het
Unc13c G A 9: 73,540,371 T1849I probably benign Het
Vav2 G A 2: 27,271,829 T655I probably damaging Het
Vps50 T C 6: 3,565,612 Y517H possibly damaging Het
Wdr27 G A 17: 14,903,537 T558I possibly damaging Het
Yeats2 C T 16: 20,159,176 R137W probably damaging Het
Other mutations in Tcirg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Tcirg1 APN 19 3899108 missense possibly damaging 0.94
IGL01735:Tcirg1 APN 19 3904210 splice site probably benign
IGL03143:Tcirg1 APN 19 3898811 missense probably damaging 1.00
R0732:Tcirg1 UTSW 19 3897866 missense possibly damaging 0.56
R1131:Tcirg1 UTSW 19 3896301 missense probably damaging 1.00
R1223:Tcirg1 UTSW 19 3898733 missense probably benign 0.01
R1548:Tcirg1 UTSW 19 3896845 missense probably benign 0.03
R1867:Tcirg1 UTSW 19 3898835 missense probably damaging 1.00
R1926:Tcirg1 UTSW 19 3902843 intron probably benign
R2262:Tcirg1 UTSW 19 3903591 missense possibly damaging 0.89
R4367:Tcirg1 UTSW 19 3899069 missense probably damaging 1.00
R5327:Tcirg1 UTSW 19 3902342 critical splice donor site probably null
R5417:Tcirg1 UTSW 19 3903509 splice site probably null
R5551:Tcirg1 UTSW 19 3898858 missense probably damaging 1.00
R5930:Tcirg1 UTSW 19 3902424 missense possibly damaging 0.95
R6026:Tcirg1 UTSW 19 3897487 missense probably benign
R6517:Tcirg1 UTSW 19 3901933 missense probably damaging 1.00
R7039:Tcirg1 UTSW 19 3896666 missense probably damaging 1.00
R7181:Tcirg1 UTSW 19 3903576 missense probably null 0.56
R7422:Tcirg1 UTSW 19 3899008 missense possibly damaging 0.61
R7631:Tcirg1 UTSW 19 3897160 missense probably damaging 1.00
R7768:Tcirg1 UTSW 19 3902900 missense possibly damaging 0.91
R7899:Tcirg1 UTSW 19 3899104 missense probably damaging 1.00
R8110:Tcirg1 UTSW 19 3899099 missense probably damaging 1.00
R9233:Tcirg1 UTSW 19 3902543 missense probably damaging 1.00
R9292:Tcirg1 UTSW 19 3897840 missense probably damaging 1.00
R9611:Tcirg1 UTSW 19 3903400 missense probably benign 0.09
R9695:Tcirg1 UTSW 19 3902360 missense probably null 0.69
Z1176:Tcirg1 UTSW 19 3903425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGCTAGTCACTGTCCAC -3'
(R):5'- CAAGAAGGATTCACGGTTGC -3'

Sequencing Primer
(F):5'- AAGGGGCTGAGCTTGTAGCC -3'
(R):5'- CAAGAAGGATTCACGGTTGCTATTG -3'
Posted On 2021-01-18