Incidental Mutation 'R8536:Fibcd1'
ID659225
Institutional Source Beutler Lab
Gene Symbol Fibcd1
Ensembl Gene ENSMUSG00000026841
Gene Namefibrinogen C domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8536 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31813290-31846005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31816631 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 396 (E396G)
Ref Sequence ENSEMBL: ENSMUSP00000028188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028188]
Predicted Effect probably damaging
Transcript: ENSMUST00000028188
AA Change: E396G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028188
Gene: ENSMUSG00000026841
AA Change: E396G

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Blast:FBG 196 236 8e-14 BLAST
FBG 237 455 1.21e-117 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FIBCD1 is a conserved type II transmembrane endocytic receptor that binds chitin and is located primarily in the intestinal brush border (Schlosser et al., 2009 [PubMed 19710473]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,217 V217M probably benign Het
Abca4 A G 3: 122,179,745 Q1074R probably benign Het
Ablim1 T C 19: 57,182,286 probably benign Het
Acox2 A T 14: 8,256,081 D79E probably benign Het
Bpifb9b A G 2: 154,316,277 I440V probably benign Het
Ccdc7a T A 8: 128,790,120 T118S possibly damaging Het
Cntln T C 4: 84,957,049 I240T probably damaging Het
Col15a1 T C 4: 47,208,536 probably null Het
Cox18 A G 5: 90,215,018 F326S probably damaging Het
Dnm1l C A 16: 16,358,775 V31L probably benign Het
Dst C A 1: 34,197,246 L3578M possibly damaging Het
Fbxw24 G A 9: 109,623,531 T132I probably damaging Het
Fchsd1 A G 18: 37,967,770 V120A probably benign Het
Fryl G T 5: 73,100,353 T702K probably damaging Het
Gatb A T 3: 85,604,561 I208F probably damaging Het
Gm9733 A G 3: 15,296,554 *179R probably null Het
Gzmd T C 14: 56,129,701 I245V probably damaging Het
Lats2 G A 14: 57,703,038 A119V probably damaging Het
Lztfl1 A T 9: 123,711,054 F129L probably benign Het
Mmp2 A T 8: 92,830,625 Y53F probably damaging Het
Mttp G A 3: 138,104,943 R637C probably damaging Het
Ndufa8 A C 2: 36,049,300 probably benign Het
Nek11 A T 9: 105,298,339 M302K probably benign Het
Nek6 A G 2: 38,514,785 probably null Het
Numa1 C T 7: 102,001,580 A1506V probably damaging Het
Plxdc1 A T 11: 97,978,696 probably null Het
Poteg C A 8: 27,448,020 T6K probably benign Het
Rbm26 A T 14: 105,142,838 N514K possibly damaging Het
Rnf145 T C 11: 44,560,115 L422P probably damaging Het
Scn5a G T 9: 119,539,745 T238K probably damaging Het
Shd G A 17: 55,976,315 A315T probably damaging Het
Slco5a1 T G 1: 12,881,301 T593P possibly damaging Het
Stard9 G A 2: 120,714,659 R4560H possibly damaging Het
Tldc1 T C 8: 119,764,048 N320S probably benign Het
Traf3ip3 C T 1: 193,194,515 probably null Het
Trpm1 G C 7: 64,247,407 K252N probably damaging Het
Ttc7b A T 12: 100,373,544 I584K possibly damaging Het
Vmn1r218 T C 13: 23,137,365 V214A probably benign Het
Wdfy3 G T 5: 101,885,198 H2215Q probably benign Het
Wls G A 3: 159,873,111 M103I probably damaging Het
Zmat4 T C 8: 23,748,507 probably null Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Fibcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fibcd1 APN 2 31833874 missense possibly damaging 0.67
IGL01069:Fibcd1 APN 2 31821519 missense probably benign 0.37
IGL01606:Fibcd1 APN 2 31833853 missense probably benign 0.21
IGL02345:Fibcd1 APN 2 31816592 missense probably damaging 1.00
IGL02639:Fibcd1 APN 2 31817150 missense probably damaging 0.99
IGL02682:Fibcd1 APN 2 31838564 missense probably damaging 0.99
R0006:Fibcd1 UTSW 2 31838587 missense probably damaging 1.00
R1848:Fibcd1 UTSW 2 31821549 missense probably damaging 1.00
R1969:Fibcd1 UTSW 2 31816661 missense probably damaging 1.00
R2397:Fibcd1 UTSW 2 31834423 missense probably benign 0.37
R2877:Fibcd1 UTSW 2 31838666 missense probably benign 0.12
R2878:Fibcd1 UTSW 2 31838666 missense probably benign 0.12
R2940:Fibcd1 UTSW 2 31817264 missense probably damaging 1.00
R4518:Fibcd1 UTSW 2 31817195 missense probably damaging 1.00
R5272:Fibcd1 UTSW 2 31816623 missense probably damaging 1.00
R5272:Fibcd1 UTSW 2 31816624 missense probably damaging 1.00
R5594:Fibcd1 UTSW 2 31838617 missense probably damaging 1.00
R7263:Fibcd1 UTSW 2 31817210 missense probably damaging 1.00
R7686:Fibcd1 UTSW 2 31833868 missense probably damaging 0.99
R8316:Fibcd1 UTSW 2 31833779 splice site probably benign
Z1176:Fibcd1 UTSW 2 31838539 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GACATAACCAGAGGACGCTG -3'
(R):5'- CACCCAAACTCATGTGGCTG -3'

Sequencing Primer
(F):5'- AGTCTAGCGGTCCTCACG -3'
(R):5'- CAAACTCATGTGGCTGGTGGAC -3'
Posted On2021-01-18