Incidental Mutation 'R8536:Gatb'
ID659230
Institutional Source Beutler Lab
Gene Symbol Gatb
Ensembl Gene ENSMUSG00000028085
Gene Nameglutamyl-tRNA(Gln) amidotransferase, subunit B
SynonymsPet112, Pet112l, 9430026F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R8536 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location85574119-85655622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85604561 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 208 (I208F)
Ref Sequence ENSEMBL: ENSMUSP00000103301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107672] [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000107672
AA Change: I208F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103299
Gene: ENSMUSG00000028085
AA Change: I208F

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-103 PFAM
Pfam:GatB_Yqey 406 472 6.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107674
AA Change: I208F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: I208F

DomainStartEndE-ValueType
Pfam:GatB_N 64 354 6.7e-105 PFAM
GatB_Yqey 406 518 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127348
AA Change: I208F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085
AA Change: I208F

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-101 PFAM
GatB_Yqey 406 555 4.13e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.7481 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,217 V217M probably benign Het
Abca4 A G 3: 122,179,745 Q1074R probably benign Het
Ablim1 T C 19: 57,182,286 probably benign Het
Acox2 A T 14: 8,256,081 D79E probably benign Het
Bpifb9b A G 2: 154,316,277 I440V probably benign Het
Ccdc7a T A 8: 128,790,120 T118S possibly damaging Het
Cntln T C 4: 84,957,049 I240T probably damaging Het
Col15a1 T C 4: 47,208,536 probably null Het
Cox18 A G 5: 90,215,018 F326S probably damaging Het
Dnm1l C A 16: 16,358,775 V31L probably benign Het
Dst C A 1: 34,197,246 L3578M possibly damaging Het
Fbxw24 G A 9: 109,623,531 T132I probably damaging Het
Fchsd1 A G 18: 37,967,770 V120A probably benign Het
Fibcd1 T C 2: 31,816,631 E396G probably damaging Het
Fryl G T 5: 73,100,353 T702K probably damaging Het
Gm9733 A G 3: 15,296,554 *179R probably null Het
Gzmd T C 14: 56,129,701 I245V probably damaging Het
Lats2 G A 14: 57,703,038 A119V probably damaging Het
Lztfl1 A T 9: 123,711,054 F129L probably benign Het
Mmp2 A T 8: 92,830,625 Y53F probably damaging Het
Mttp G A 3: 138,104,943 R637C probably damaging Het
Ndufa8 A C 2: 36,049,300 probably benign Het
Nek11 A T 9: 105,298,339 M302K probably benign Het
Nek6 A G 2: 38,514,785 probably null Het
Numa1 C T 7: 102,001,580 A1506V probably damaging Het
Plxdc1 A T 11: 97,978,696 probably null Het
Poteg C A 8: 27,448,020 T6K probably benign Het
Rbm26 A T 14: 105,142,838 N514K possibly damaging Het
Rnf145 T C 11: 44,560,115 L422P probably damaging Het
Scn5a G T 9: 119,539,745 T238K probably damaging Het
Shd G A 17: 55,976,315 A315T probably damaging Het
Slco5a1 T G 1: 12,881,301 T593P possibly damaging Het
Stard9 G A 2: 120,714,659 R4560H possibly damaging Het
Tldc1 T C 8: 119,764,048 N320S probably benign Het
Traf3ip3 C T 1: 193,194,515 probably null Het
Trpm1 G C 7: 64,247,407 K252N probably damaging Het
Ttc7b A T 12: 100,373,544 I584K possibly damaging Het
Vmn1r218 T C 13: 23,137,365 V214A probably benign Het
Wdfy3 G T 5: 101,885,198 H2215Q probably benign Het
Wls G A 3: 159,873,111 M103I probably damaging Het
Zmat4 T C 8: 23,748,507 probably null Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Gatb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gatb APN 3 85601920 missense possibly damaging 0.95
IGL00963:Gatb APN 3 85618948 missense probably benign 0.00
IGL01363:Gatb APN 3 85652345 missense probably damaging 1.00
IGL01650:Gatb APN 3 85613484 missense possibly damaging 0.68
IGL01973:Gatb APN 3 85611424 missense probably damaging 1.00
IGL02195:Gatb APN 3 85604448 missense probably benign 0.00
IGL02670:Gatb APN 3 85613551 splice site probably null
IGL02992:Gatb APN 3 85618916 missense probably damaging 1.00
IGL03025:Gatb APN 3 85575874 missense probably damaging 0.99
IGL03035:Gatb APN 3 85601947 missense probably damaging 1.00
IGL03090:Gatb APN 3 85619023 intron probably benign
R1313:Gatb UTSW 3 85653826 missense probably benign 0.01
R1851:Gatb UTSW 3 85618877 missense probably damaging 0.99
R1852:Gatb UTSW 3 85618877 missense probably damaging 0.99
R2134:Gatb UTSW 3 85611370 missense probably damaging 1.00
R2209:Gatb UTSW 3 85653805 missense probably benign 0.03
R5189:Gatb UTSW 3 85636931 missense probably benign 0.00
R5218:Gatb UTSW 3 85604444 missense probably benign
R5857:Gatb UTSW 3 85575932 missense probably damaging 1.00
R5871:Gatb UTSW 3 85653776 nonsense probably null
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6430:Gatb UTSW 3 85637038 missense probably benign 0.01
R6661:Gatb UTSW 3 85652419 splice site probably null
R7184:Gatb UTSW 3 85636951 nonsense probably null
R7210:Gatb UTSW 3 85574220 missense probably benign
R7501:Gatb UTSW 3 85636990 missense probably damaging 0.99
R7919:Gatb UTSW 3 85604521 missense probably damaging 1.00
R8335:Gatb UTSW 3 85574321 critical splice donor site probably null
X0013:Gatb UTSW 3 85601861 missense probably damaging 1.00
Z1177:Gatb UTSW 3 85636973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCGAATCCCAGCTTTCAG -3'
(R):5'- AAACCTGGCAGGACCCTCTAAG -3'

Sequencing Primer
(F):5'- CTGGTCTAGCAACTAAATCCGTG -3'
(R):5'- TGCTTAAGGACATCCAGCTG -3'
Posted On2021-01-18