Incidental Mutation 'R8536:Abca4'
ID 659231
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene Name ATP-binding cassette, sub-family A (ABC1), member 4
Synonyms D430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission
Accession Numbers

Genbank: NM_007378; MGI: 109424
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8536 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 122044443-122180123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122179745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 1074 (Q1074R)
Ref Sequence ENSEMBL: ENSMUSP00000143560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]
AlphaFold O35600
Predicted Effect probably benign
Transcript: ENSMUST00000013995
AA Change: Q2282R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: Q2282R

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141135
AA Change: Q1074R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: Q1074R

DomainStartEndE-ValueType
Blast:AAA 1 172 9e-78 BLAST
Pfam:ABC2_membrane_3 311 686 1.9e-42 PFAM
AAA 755 939 1.2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,217 V217M probably benign Het
Ablim1 T C 19: 57,182,286 probably benign Het
Acox2 A T 14: 8,256,081 D79E probably benign Het
Bpifb9b A G 2: 154,316,277 I440V probably benign Het
Ccdc7a T A 8: 128,790,120 T118S possibly damaging Het
Cntln T C 4: 84,957,049 I240T probably damaging Het
Col15a1 T C 4: 47,208,536 probably null Het
Cox18 A G 5: 90,215,018 F326S probably damaging Het
Dnm1l C A 16: 16,358,775 V31L probably benign Het
Dst C A 1: 34,197,246 L3578M possibly damaging Het
Fbxw24 G A 9: 109,623,531 T132I probably damaging Het
Fchsd1 A G 18: 37,967,770 V120A probably benign Het
Fibcd1 T C 2: 31,816,631 E396G probably damaging Het
Fryl G T 5: 73,100,353 T702K probably damaging Het
Gatb A T 3: 85,604,561 I208F probably damaging Het
Gm9733 A G 3: 15,296,554 *179R probably null Het
Gzmd T C 14: 56,129,701 I245V probably damaging Het
Lats2 G A 14: 57,703,038 A119V probably damaging Het
Lztfl1 A T 9: 123,711,054 F129L probably benign Het
Mmp2 A T 8: 92,830,625 Y53F probably damaging Het
Mttp G A 3: 138,104,943 R637C probably damaging Het
Ndufa8 A C 2: 36,049,300 probably benign Het
Nek11 A T 9: 105,298,339 M302K probably benign Het
Nek6 A G 2: 38,514,785 probably null Het
Numa1 C T 7: 102,001,580 A1506V probably damaging Het
Plxdc1 A T 11: 97,978,696 probably null Het
Poteg C A 8: 27,448,020 T6K probably benign Het
Rbm26 A T 14: 105,142,838 N514K possibly damaging Het
Rnf145 T C 11: 44,560,115 L422P probably damaging Het
Scn5a G T 9: 119,539,745 T238K probably damaging Het
Shd G A 17: 55,976,315 A315T probably damaging Het
Slco5a1 T G 1: 12,881,301 T593P possibly damaging Het
Stard9 G A 2: 120,714,659 R4560H possibly damaging Het
Tldc1 T C 8: 119,764,048 N320S probably benign Het
Traf3ip3 C T 1: 193,194,515 probably null Het
Trpm1 G C 7: 64,247,407 K252N probably damaging Het
Ttc7b A T 12: 100,373,544 I584K possibly damaging Het
Vmn1r218 T C 13: 23,137,365 V214A probably benign Het
Wdfy3 G T 5: 101,885,198 H2215Q probably benign Het
Wls G A 3: 159,873,111 M103I probably damaging Het
Zmat4 T C 8: 23,748,507 probably null Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 splice site probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 splice site probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7935:Abca4 UTSW 3 122110537 missense possibly damaging 0.85
R8237:Abca4 UTSW 3 122162303 missense probably benign 0.00
R8255:Abca4 UTSW 3 122155277 missense probably benign 0.00
R8294:Abca4 UTSW 3 122103568 missense possibly damaging 0.75
R8504:Abca4 UTSW 3 122129334 missense probably benign 0.01
R8714:Abca4 UTSW 3 122148879 missense probably benign 0.19
R8771:Abca4 UTSW 3 122086671 missense probably damaging 0.97
R8835:Abca4 UTSW 3 122102784 missense probably benign 0.00
R8845:Abca4 UTSW 3 122137002 missense probably damaging 1.00
R8856:Abca4 UTSW 3 122112447 missense probably benign
R8933:Abca4 UTSW 3 122128137 missense probably damaging 1.00
R9052:Abca4 UTSW 3 122147259 missense possibly damaging 0.68
R9095:Abca4 UTSW 3 122173907 missense possibly damaging 0.52
R9221:Abca4 UTSW 3 122128179 missense probably damaging 1.00
R9262:Abca4 UTSW 3 122170990 missense probably damaging 1.00
R9301:Abca4 UTSW 3 122087479 missense probably benign 0.24
R9367:Abca4 UTSW 3 122044548 start codon destroyed probably null 0.99
R9408:Abca4 UTSW 3 122137625 missense probably benign
R9425:Abca4 UTSW 3 122132695 missense probably damaging 1.00
R9464:Abca4 UTSW 3 122120065 missense probably benign 0.08
R9483:Abca4 UTSW 3 122085626 missense
R9751:Abca4 UTSW 3 122087477 missense probably benign 0.00
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Z1189:Abca4 UTSW 3 122083993 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAAGAAATCAGGGCAGCCTACTC -3'
(R):5'- GGGTTCTGGATAAACAGGTGAC -3'

Sequencing Primer
(F):5'- AGGGCAGCCTACTCAATGTTCTG -3'
(R):5'- ACAGGTGACCATTCTGATAGGTC -3'
Posted On 2021-01-18