Incidental Mutation 'R8536:Trpm1'
ID 659239
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8536 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 64153835-64269775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 64247407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 252 (K252N)
Ref Sequence ENSEMBL: ENSMUSP00000145593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
AlphaFold Q2TV84
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: K1136N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: K1136N

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: K1020N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: K1142N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206314
AA Change: K252N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206848
AA Change: K36N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,217 V217M probably benign Het
Abca4 A G 3: 122,179,745 Q1074R probably benign Het
Ablim1 T C 19: 57,182,286 probably benign Het
Acox2 A T 14: 8,256,081 D79E probably benign Het
Bpifb9b A G 2: 154,316,277 I440V probably benign Het
Ccdc7a T A 8: 128,790,120 T118S possibly damaging Het
Cntln T C 4: 84,957,049 I240T probably damaging Het
Col15a1 T C 4: 47,208,536 probably null Het
Cox18 A G 5: 90,215,018 F326S probably damaging Het
Dnm1l C A 16: 16,358,775 V31L probably benign Het
Dst C A 1: 34,197,246 L3578M possibly damaging Het
Fbxw24 G A 9: 109,623,531 T132I probably damaging Het
Fchsd1 A G 18: 37,967,770 V120A probably benign Het
Fibcd1 T C 2: 31,816,631 E396G probably damaging Het
Fryl G T 5: 73,100,353 T702K probably damaging Het
Gatb A T 3: 85,604,561 I208F probably damaging Het
Gm9733 A G 3: 15,296,554 *179R probably null Het
Gzmd T C 14: 56,129,701 I245V probably damaging Het
Lats2 G A 14: 57,703,038 A119V probably damaging Het
Lztfl1 A T 9: 123,711,054 F129L probably benign Het
Mmp2 A T 8: 92,830,625 Y53F probably damaging Het
Mttp G A 3: 138,104,943 R637C probably damaging Het
Ndufa8 A C 2: 36,049,300 probably benign Het
Nek11 A T 9: 105,298,339 M302K probably benign Het
Nek6 A G 2: 38,514,785 probably null Het
Numa1 C T 7: 102,001,580 A1506V probably damaging Het
Plxdc1 A T 11: 97,978,696 probably null Het
Poteg C A 8: 27,448,020 T6K probably benign Het
Rbm26 A T 14: 105,142,838 N514K possibly damaging Het
Rnf145 T C 11: 44,560,115 L422P probably damaging Het
Scn5a G T 9: 119,539,745 T238K probably damaging Het
Shd G A 17: 55,976,315 A315T probably damaging Het
Slco5a1 T G 1: 12,881,301 T593P possibly damaging Het
Stard9 G A 2: 120,714,659 R4560H possibly damaging Het
Tldc1 T C 8: 119,764,048 N320S probably benign Het
Traf3ip3 C T 1: 193,194,515 probably null Het
Ttc7b A T 12: 100,373,544 I584K possibly damaging Het
Vmn1r218 T C 13: 23,137,365 V214A probably benign Het
Wdfy3 G T 5: 101,885,198 H2215Q probably benign Het
Wls G A 3: 159,873,111 M103I probably damaging Het
Zmat4 T C 8: 23,748,507 probably null Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 64268880 missense probably benign 0.06
R8954:Trpm1 UTSW 7 64208341 missense probably damaging 0.98
R9139:Trpm1 UTSW 7 64199195 missense probably benign 0.00
R9205:Trpm1 UTSW 7 64240571 missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 64234965 missense probably benign 0.01
R9283:Trpm1 UTSW 7 64223875 missense probably benign 0.18
R9394:Trpm1 UTSW 7 64268732 missense probably benign 0.00
R9430:Trpm1 UTSW 7 64223698 missense probably benign 0.38
R9537:Trpm1 UTSW 7 64153868 unclassified probably benign
R9616:Trpm1 UTSW 7 64208384 missense probably damaging 0.99
R9774:Trpm1 UTSW 7 64248293 missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- CAACAAGCATGTGTCTTTGAGC -3'
(R):5'- TGAAGAGTCCCCAACGTACTC -3'

Sequencing Primer
(F):5'- TTGAGCATAGATAATCCACACTGGG -3'
(R):5'- GTACTCAACCCACGGTCCCG -3'
Posted On 2021-01-18